CBrugiaQ_2174


Sequence

>CBrugiaQ_2174 (4 EST) Length=398 ACCCAAGTTTGAAGTAATACGGATTAATGGAGTTGGCAGAGAAGTTATTGACAAGAAATAAAATCGATATTAAGTTGTGT TACAATTATTGTGTTTCATAAAAGAATGGGACAGTGCATAATACACATTGGTATCGATAACGCTTGATAATNGAATTCCG GGTTTANTTACCCAAGTTTGAGATAACGAAGCTAACCAGAAATGTTTGTACCACGTGGACTAGAAGCTGGTGCCAATGTA GCAGCGCAACAGGTGGAAGAACGTCGACGAGCTCAACTAGAAACTAGAAATGATGCTCTACGTTTTTTGTTAATTCCAAT TGCTTTGGAACTTGGAGCTCATTTCTGTAGTTTGGTGCTCGGTTGGGATTGGATATGCACATAAATTTGGTAGAATTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST, Processing,


Cluster Information for CBrugiaQ_2174: (4 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4448831172265N43382AS4SLC466T3Brugia malayi L4 JHU93SL-BmL4
8810461871030AA241431MBL2SJ8H4T3Brugia malayi second stage larvae JHU96SL-BmL2
8811291871113AA241509MBL2SJ9H4T3Brugia malayi second stage larvae JHU96SL-BmL2
8982331892838AA257362MB4SLM2A1T3Brugia malayi L4 JHU93SL-BmL4


Date: 4:23:13 on Fri 24 Nov 117.