CBrugiaQ_2175


Sequence

>CBrugiaQ_2175 (3 EST) Length=394 TTTGGAAATGGAAATCCATTTTATTACTAGAATCATTTTCAGAACAATGGCATGAAGCATGAAGTAACTATTTATTTATT TACTCGATTTCGATCCTGATGAACGTAACATTCGTTCGAGAAATTTCTTATTCGTTTTTAAACAGCTTGGCTTTTTCCAG CCCTGTGGTCCAGTTATTTCGTAGCGACGAATACCCAACATAGCATCCTTAAGAATCTCTTCTCGAGCTTTCTTTTCTAA TTCAGATAGGCCACTCTTATGCGTTTCAGTATTAGACAGTTGTACTTCCGCGGTTACCATATTTATATTTTTTCTCACTT TGATAATCAGCTTATCCAGTTGACGGAGTTTGGACCGATTAGCTGTTTCATTCATTGATTAGAACTTCCTCCCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CBrugiaQ_2175: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
1435315
299989914358H39277SWAMCA268SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
10859832153567AA441689SW3ICA2500SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 22:17:3 on Sat 18 Nov 117.