CBrugiaQ_2186


Sequence

>CBrugiaQ_2186 (2 EST) Length=390 CAAGTTTGAGTAAATATTGTTTGATTGAAAATGAGACGCTTCGGGATCGAGCCAATATGGACATCGGAAGATACGAGGAA TGCTATCCTGGCTAGCCTGATACCTGGTGCCACTGCTTTTACAGCATTTGCTGTATTTGCAAATGATCGCAACGTTGTAG ATTGGTGGACACATGCAAAGAAGCCAAACTGGGCTCCAAAGGATCCAGTGGTATATTCTCTTTTTGATATTGTGACACTT AGCCCGTTGGGATATGCATCCTATCTTGTTTACAAGAACGGAGGTGGTTTGCATTACACCGATACGAAGGTAGCTCTTGG ATTATATGGGTTAAACACGATCTTTGCTCTCACAACAATTCCTTTAATCAAGAAGATGAATTTTACTTCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CBrugiaQ_2186: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11537972247011AA509134MBAFCX7F10T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11538072247021AA509144MBAFCX7G10T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 16:11:48 on Sun 19 Nov 117.