CBrugiaQ_2198


Sequence

>CBrugiaQ_2198 (35 EST) Length=728 AGAATACGGAACGACCCAAGTTTGAGGAAATATGGGCGCATACCGTTACATGCAAGAGCTTTGGCGTAAGAAGCAATCAG AGACGATGCGCTATTTGCTTCGAATACGCTGCTGGCAATATCGACAACTCACCGCTATTCATCGTGTCTCCAGACCAACG CGCCCCGAGAAGGCTCGCAGATTAGGCTATCGTGCGAAGCAAGGTTACATTATCTATCGTGTGAGAGTACGCAGAGGTGG TCGTAAGCGCCACGTCGTGAAAGGTCAAACATATGGTAAACCAAAAAACCATGGCGTTAATGAGTTGAAATTTGCTCGCT GTAAACAGTCTGTTGCTGAGGAGAGAGTTGGGCGTCGATGTGGCAGTCTTCGTGTATTGAATTCTTATTGGGTTGGCCAA GATTCTACATACAAGTTCTATGAAGTTATTATGATTGATCCGGCTCATAAGGCTATTCGAAGAAATCCAGACACACAATG GATAACGAAGCCTGTTCATAAACATCGCGAGTTGCGTGGGTTGACGTCTGCTGGTCGCAGAAGTCGAGGTCTTGGTAAAG GACATCACTATTCAGCAACGAAGGGAGGTTCACGTAGGAAGTGTTGGTTGCGTCGTAATACTTTATCGCTTCGTCGTAAA CGTTAACATGAAATATAAGATAAGATTGTTATGTATTTCGTGCTGTTTACGTTAAATGAAAAGTTAAGGCTATGAAATGC TTGATTTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CBrugiaQ_2198: (35 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
217710808532R47645AS3ISB031SLBrugia malayi infective L3 JHU93SL-BmL3
3658021019975H64214RRAMCA008SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
4255571141658N27310SWMFCA228SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
4449331172315N43432AS4SLC545T3Brugia malayi L4 JHU93SL-BmL4
4459681182985N44466SWMFCA188SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
4809641236201N74802RRAMCA1073SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
5304651300215W23361SWAMCA512SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
5594841345305W51592AS4SLC838T3Brugia malayi L4 JHU93SL-BmL4
6364391486204AA022422SWMFCA588SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
6722481537195AA052017SWMFCA724SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
7471591660769AA109285MBAFCE0B09T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8712961854368AA231954AS3ISB004T3Brugia malayi infective L3 JHU93SL-BmL3
8808371870821AA241472MBL2SJ0B12T3Brugia malayi second stage larvae JHU96SL-BmL2
8808871870871AA241553MBL2SJ0G8T3Brugia malayi second stage larvae JHU96SL-BmL2
8809491870933AA241667MBL2SJ2E11T3Brugia malayi second stage larvae JHU96SL-BmL2
8809591870943AA241573MBL2SJ2G6T3Brugia malayi second stage larvae JHU96SL-BmL2
8810081870992AA241583MBL2SJ8D8T3Brugia malayi second stage larvae JHU96SL-BmL2
8810181871002AA241697MBL2SJ8E7T3Brugia malayi second stage larvae JHU96SL-BmL2
8810661871050AA241451MBL2SJ9B7T3Brugia malayi second stage larvae JHU96SL-BmL2
8855221876926AA246118SWMFCA1581SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
8944821887907AA253558SWMFCA1606SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
8980971892702AA257174SWMFCA1459SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
8983301892935AA257459MBAFCZ0B9T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8987161893321AA257740MBL2SJ3G5T3Brugia malayi second stage larvae JHU96SL-BmL2
8987541893359AA257843MBL2SJ4B9T3Brugia malayi second stage larvae JHU96SL-BmL2
9164291917049AA275414MB4SLY1C06T3Brugia malayi L4 JHU93SL-BmL4
9164381917058AA275423MB4SLY1D03T3Brugia malayi L4 JHU93SL-BmL4
10774502125754AA433156RRAMCA1595SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
10777022130885AA433408SWAMCA1625SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
10988502168020AA454351MBAFCX0E08T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11163142199455AA471691MBAFCX5E03T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11888142289678AA542766MBL2SK3B10T3Brugia malayi second stage larvae JHU96SL-BmL2
11919422307184AA545893SWMFCA2445SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
12774122429554AA598361SWMFCA2918SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
13814672655587AA675881MBAFCW5H06T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 18:53:10 on Sat 18 Nov 117.