CBrugiaQ_220


Sequence

>CBrugiaQ_220 (2 EST) Length=782 CNCANTAGGCATATATNTAGTNCTATANCACATTTCAATAATTTCCACAGTCAAATAATTATGACTAAAATTAAATTAGC AGCTTTTTCGGCTATAATTACTTCAATTATTACAATAACATTTATTTTTACACAAATTCATCAATTTTTTGGTTCTATTA CAATGCTAAAATATAAATTAACCATAGGAATGGATGAATTTATGATTATGCAAGATCAAACATGGATCGAATTACAAGAA GCACGGCTAATGCAACCAATAAAACAAAAACGTTTGGTTCGTCAGGTAAAACCGGAACCGAAATGCAACTGTGATACGTC GAATCGATGTCCACCAGGTCCACCAGGTAGACCAGGTATGGATGGAATGGATGGTATGCCTGGTCAACCAGGTCCACCAG GTGAACCTGGTCTTCCGGGAATTGCTGTACCAATTGAGCCATTGAAAAGATTATGGTTCATGTCGGGTATGTCCTCCAGG ACCAGCTGGTCATATGGGTGTATCCAGGAGCACCTGGTTCACCAGGAACACAGGGTGCACCTGGAAATGATGGCCTACCA GGTCATCCAGGTCNACCTGGTCAACTTGGATCACCGGGTNGAAAGAAGTGAACCCACGACCAATTGGTAAAGATGGACCA NTCCGAACACCAGGTCCAAAAAGGATTCCCGTGGCNTACCGGGTGCATCAGGTTGAACCANGTCCCCTTTGGTCCAATTT GAACCTAANGTTTCCTNGGTTCCCCCCCAAGGAAATTCCNGNAATCCCNGGTTACNCAAGGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CBrugiaQ_220: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12617332392929AA585517SW3D9CA068SKBrugia malayi L3 molting-day 9 larva cDNA (SAW97MLW-BmL3d9)
13870702663010AA681005SW3D9CA526SKBrugia malayi L3 molting-day 9 larva cDNA (SAW97MLW-BmL3d9)


Date: 22:42:25 on Thu 23 Nov 117.