CBrugiaQ_2202


Sequence

>CBrugiaQ_2202 (2 EST) Length=389 TGAGGACTTGTAGAAAATCAGAGTATTTCGGAGGAGCGCCAGGCCATTGAAGAGGCCATCGAGGAGAACGAGGAAGAGCG CATTCCTCACGAATCTTTCTATTCAGGCATATTAGGGGAGACTTCCCTTCCTGAAAAATTCACTTCCAACAATAACGCAC GATTTATTTCAGCAGCGTCACCAGCGAAGATGAGTGTCACACCAAATCGTTATTTGCGTGGATGCATTGACGTATTTCTC TTCATCCTGTGTTTGGCGCTTGTAATCTTACAATTTGGCCTTCTAGACTTTTATTACTTAACTGTCCTGAAGGATAATAT CTGGTATACCTGGATAGGAGCCGATTCACTCGTCATTGTTATCCTCATATGGCTCCTTGTTATAGTGGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CBrugiaQ_2202: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
350195988826H48985SWMFCA032SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
10482312064878AA406808MBAFCZ6D12T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 17:49:7 on Tue 21 Nov 117.