CBrugiaQ_2203


Sequence

>CBrugiaQ_2203 (46 EST) Length=446 GCCAAGACGACAACAAAGTTTTATTTCAATAAAACAGACTCAAATACAAATATTCCAGTAGACGCTTTATAATCACTTAT GATGTTTACGAAGATTTGTAAGGATTGCCTGAATCTCGTCACGCTTTCTCTTTGCACGAACATGTGAACCAATACGCCTC TTCAAAAACTTTAATGCCTTCTTGTCTTTGCTAATTCTCAGCAATTCCATTGTTCGTCTTTCGTAAGGAGCAAACCCAGC AACTTCACGAATCAGTTCACGAACAATTTTACTCCTTTTGGTTATACGTCCTTTACGTCTACTTTGACGCATTTTCCTTT GATTTTTCGTTACCTTGTAACCAGCATTAAGACCCACAGCAACTGCTTCAACTGCGACCATTTCTTTTCCTCAAACTTGG GTAATTAAACCCGGAATTCAGGATTTAATGACGCAACAAGCAGTCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST, Processing,


Cluster Information for CBrugiaQ_2203: (46 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
217686808508R47621AS3ISB011SLBrugia malayi infective L3 JHU93SL-BmL3
333895965454R93100SWAMCA429SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
3939281081917H91487SWMFCA070SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
4061411115046H97274KJ4SLB066T3JHU93SL-BmL4 (JHU)
4449511172333N43450AS4SLC573T3Brugia malayi L4 JHU93SL-BmL4
4449551172337N43454AS4SLC787T3Brugia malayi L4 JHU93SL-BmL4
4449571172339N43456AS4SLC785T3Brugia malayi L4 JHU93SL-BmL4
4449731172355N43472AS4SLC820T3Brugia malayi L4 JHU93SL-BmL4
4449741172356N43473AS4SLC818T3Brugia malayi L4 JHU93SL-BmL4
4450021172384N43501AS4SLC796T3Brugia malayi L4 JHU93SL-BmL4
5594361345257W51643AS4SLC620T3Brugia malayi L4 JHU93SL-BmL4
5594611345282W51569AS4SLC752T3Brugia malayi L4 JHU93SL-BmL4
5594791345300W51587AS4SLC799T3Brugia malayi L4 JHU93SL-BmL4
5595041345325W51623AS4SLC885T3Brugia malayi L4 JHU93SL-BmL4
7062261592644AA072543MB4SLD065T3Brugia malayi L4 JHU93SL-BmL4
8002941737677AA161647MBAFCG0B10T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8557931817196AA216492AS4SLC663M13RBrugia malayi L4 JHU93SL-BmL4
8557971817200AA216496AS4SLC704T3Brugia malayi L4 JHU93SL-BmL4
8678851850650AA228544KJ4SLB336T3JHU93SL-BmL4 (JHU)
8678881850653AA228547KJ4SLB360T3JHU93SL-BmL4 (JHU)
8712861854358AA231944AS3ISB108T3Brugia malayi infective L3 JHU93SL-BmL3
8712921854364AA231950AS3ISB011T3Brugia malayi infective L3 JHU93SL-BmL3
8808401870824AA241475MBL2SJ0C3T3Brugia malayi second stage larvae JHU96SL-BmL2
8808601870844AA241526MBL2SJ0E4T3Brugia malayi second stage larvae JHU96SL-BmL2
8809021870886AA241594MBL2SJ0H12T3Brugia malayi second stage larvae JHU96SL-BmL2
8809301870914AA241622MBL2SJ2C9T3Brugia malayi second stage larvae JHU96SL-BmL2
8809471870931AA241665MBL2SJ2E9T3Brugia malayi second stage larvae JHU96SL-BmL2
8809831870967AA241675MBL2SJ8B4T3Brugia malayi second stage larvae JHU96SL-BmL2
8810031870987AA241721MBL2SJ8D3T3Brugia malayi second stage larvae JHU96SL-BmL2
8810151870999AA241590MBL2SJ8E4T3Brugia malayi second stage larvae JHU96SL-BmL2
8810961871080AA241416MBL2SJ9E5T3Brugia malayi second stage larvae JHU96SL-BmL2
8855031876907AA246099SWMFCA1557SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
8981971892802AA257300MB4SLM1D3T3Brugia malayi L4 JHU93SL-BmL4
8987251893330AA257814MBL2SJ3H2T3Brugia malayi second stage larvae JHU96SL-BmL2
9101121906177AA269115KJ4SLB044T3JHU93SL-BmL4 (JHU)
9101281906193AA269131KJ4SLB084T3JHU93SL-BmL4 (JHU)
9164551917075AA275440MB4SLY1E09T3Brugia malayi L4 JHU93SL-BmL4
9164561917076AA275441MB4SLY1E10T3Brugia malayi L4 JHU93SL-BmL4
9164861917106AA275471MB4SLY1H05T3Brugia malayi L4 JHU93SL-BmL4
9165091917129AA275481MBL2SK1B11T3Brugia malayi second stage larvae JHU96SL-BmL2
10482482064895AA406890MBAFCZ6F07T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
10774362125740AA433142RRAMCA1576SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
11939082315060AA547859MB3D6V2A03T3Brugia malayi day 6 post-infection third stage larvae SAW96MLW-BmL3d6
12652232402594AA588931KJ4SLB403T3JHU93SL-BmL4 (JHU)
12652312402602AA588939KJ4SLE018T3JHU93SL-BmL4 (JHU)
13736242629539AA668040MBL2SJ3H7AT3Brugia malayi second stage larvae JHU96SL-BmL2


Date: 23:27:41 on Fri 17 Nov 117.