CBrugiaQ_2211


Sequence

>CBrugiaQ_2211 (2 EST) Length=661 ATACTTTCTCGATGTATTCATTTGCATCATCAGTTCTGTACAACTGGCGTAATTTGGGCAACATTGTCTCAATGATGTAC ATTTTTTTCTCATTGGAGCCGTTATGGCCTTGCAATAGTCAAAAGCATTTTGTCGTGTTTTCAAATTATTGAATTTGCAT TTGTCAACATCATTTGTCCCATTGAGAATGTCATCCGTCACCATCTCTTCACAGATCGTTTTATTATGGATAGGAAGTGG ATTCTGGCTGGAAACAGTTTGACGCATACATAATTTACGACTTAGTTCCATTTTATGCAAAAGTTTTGAGAGCTGTCGTA GAATATCGCTGGGTATCCGCCTCAAACCTCGTGCCGAATTCGGCACGAGCACGTGCCGAATTCTTGTTCATACTATCATT ATAATTCTTATTCCTTCTTCATGATTAATAAATTGTTATGTAAGTGTTGCGTGCTGTTTGTTATTGTTACATTTTGCAGT CGATGGCTAGATTTCATCTACATCTCATTAGTCATGTGTCGTAAAACTAATGAAAATTACTGTACTGTTCTGCAGGTCGT AAAGAATGGAATTAATTGTCTTTGTTAGTTTGAAGTTTGAGTATGGATAGCTTGCACGTGGAGATTGTTAGATTGAAGTG TGGGTGGGCTGAACTTTTTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CBrugiaQ_2211: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8197181763899AA180681MBAFCG3B04T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11938612315013AA547812MB3D6V1C04T3Brugia malayi day 6 post-infection third stage larvae SAW96MLW-BmL3d6


Date: 7:14:38 on Mon 20 Nov 117.