CBrugiaQ_222


Sequence

>CBrugiaQ_222 (2 EST) Length=767 CAAAAATTGATACACTGATGCTCCTACCTGGATTATTGACCCAATTGATGGCACCACGAACTTCGTCCATAGAATTCCAA TTATCGCTATATGTGTAGGACTGGCTATCAAGAAGCAGTTACGCGCCGGAATTGTTTATAATCCAATTACTAAAGAGCTT TATACAGCACAATCAGGACGAGGAGCTTTTCGAAATGGGTTTCCAATTCATGTTTCTGCTACCAAAGAAATAAGTCGATG CCTACTTGGTCAGTCTCATGGGATTCATAATTTGGTTGAATTCGGCGAAAAGTGGTTAAAAATAACATTAGATAATCATG GCCGGCAATGTCTTGCAGGCATACGAAGACATCGTTCATTTGGTTCTGCAGCTATGAATATGATTTATGTGGCTCAAGGT GGGACTGGATGCATATGTTGAATATGGTCTCCATGCATGGGATGTTGCTGCCGCTGGAATTATTGTTAAAGAAGCAGGTG GTGTATTACTAGATCCAACAGGAGCCGAATTTGACATTATGGGTCGTCGAGTTCTCTGTACGTCAACTCCTGAACTGGCT AGAGCAATAAAATCAACTCTCACTCATGTTGAATATGACAAAGAAGGATGAATTCATTTTATCATCTTTTTTTATGCATC TGATTTGGCCAATATTACCACTGCAAATAATTCTATGTAGAAATGATTTGTCATAAGTATGTAATCGTCCAATGATCATT AGAAGGAATTGATCGANAATTTTAACTAGAAATATTTTACTGTATTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CBrugiaQ_222: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8639531845401AA224620SWMFCA1049SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
11536432246857AA508980MBAFCW1H04T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 1:19:11 on Tue 21 Nov 117.