CBrugiaQ_2221


Sequence

>CBrugiaQ_2221 (22 EST) Length=653 AGAAACCAGAATATATTATAAAATATATATAGATAATAAGAGTAATGTAATAGGAACAATATAAATAAAAATGATAATGA TAGTAAATAATAATCTATATTAATGAAATAATAAAATAATCTGCGTATAAATATTTATATATATATTAAAAAACAAAAAG GATTAAATAGATGAAAAAGACGAGGAAGTGTTTTTTTTCCACAGAAATATAAACACAATTTTACATCCACATTTTCGATA TATATATTCTTAATGCAGCATAAAAGCACAATATGTAAAATGTATTTCCCTAAATAGTATTAAATATCAGTACGATATAT TTGCTTCCTCTCATTCCCATATAAATAGCTTCGTCTCTCTCTCTATCCTCGTGCCGAATTCGTATTGCATATCAANAGAA GTTTTTATCATAATTTATGAATAATAGAAATAAAGTGTCAAGGTTTTATAATTTTTTATTTTTACGAAATTAATTATAAT TATAACTTTGTATTGATATAACGTACTTTTATTTCTGTTTTTTTTTATATTTATAGTTAAGTTATATTTCCATTTTATAT AGTTTTAATATAATTTTTTTTTAAATGTTGTTTATTTGGTTTAAATATTTATTTTTTTTTTTTTTTTTTTNGGGGGAAAT TTTTAANATAATT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CBrugiaQ_2221: (22 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
217732808554R47667SWAMCA016SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
291596902128H30972SW3ICA221SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
320178944794R86388SW3ICA337SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
3658181019991H64230RRAMCA038SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
4384911158240N37098SW3ICA611SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4446211167422N43117SW3ICA952SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4446341167435N43133SWMFCA328SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
4459251182942N44423SW3ICA1232SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
6186191463720AA007715SWAMCA815SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
6838401550599AA057946SWMFCA968SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
7092401613914AA074010SW3ICA1665SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
7272161634861AA089382SW3ICA1587SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
7473221660932AA109436MBAFCE2D02T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
7496621663666AA111776SW3ICA1863SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
8390291795694AA199951SW3ICA1984SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
8713261854982AA232019SWMFCA1330SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
9141591912529AA273155SW3ICA2581SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
10750722113549AA430792RRAMCA1457SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
10859952153579AA441701SW3ICA2515SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
11537302246944AA509067MBAFCX6H04T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11537822246996AA509119MBAFCX7E05T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11938732315025AA547824MB3D6V1D10T3Brugia malayi day 6 post-infection third stage larvae SAW96MLW-BmL3d6


Date: 3:50:50 on Sat 18 Nov 117.