CBrugiaQ_2233


Sequence

>CBrugiaQ_2233 (2 EST) Length=368 ACCCAAGTATGAGGATTAAAGCTACCACTGATCAAATAAACCGGAATAAAACGGCGATGCAATTCAGCAACCAAAGCTTC ACCACCTGATGGATTCACGAAATGAAATTTCACCATTCATTGTTCCCTCAGTAAATCTGACGACTTCGTAGCAGTGAAGA TATTTCGCAAATTCATCGATCATTTCGCAAGTGCATAAGGTGGAATCGACATCGAAACAAACAGCATCTGCCATCTGCCA GAGTTTTTTGGCTCGAGCTTCCCTTGTTCTCAGTGAGACTATCCGCAGCTTCATCTTCCAACATACTTTAGAAATCAGTG CTGTGCAAAAGCTTTTCAACAGTAATTCAACAATAAATTCGCATTTGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CBrugiaQ_2233: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
296601905405H35901SWAMCA035SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
4448761172258N43375AS4SLC455T3Brugia malayi L4 JHU93SL-BmL4


Date: 18:50:54 on Sun 19 Nov 117.