CBrugiaQ_2234


Sequence

>CBrugiaQ_2234 (10 EST) Length=374 ACCCAAGTTTGACGCGAAAGTAATACCTGGAACTGGAAACAATGAAGTTGTCATCGACACAACAGAATTTGGTACGACAA ACGGCAAATATTTTTCGGATTTTTGTACAATGGGGAAGTGTTCCTTTTATTGTGTACTTAGGATTTCGTCATGGAGCTGA CCCACAACCAAACGGTGAAGTGATACCGCTTTCATTAAGTGGTCTTCTCTATGGATGAAACCTCCAGTTTACAAGCAACT AGTTCTTGCTAACTAGTTCACTTCCTTTTAATTATGCAGACTAATTTGCGGACATTTTCGTTATTGAAGATATAATTTCA TCACTTTGCTATATGTCAAATAAAAATTTCCAACTACTAACACCCCCTCCCTCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CBrugiaQ_2234: (10 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
217698808520R47633AS3ISB022SLBrugia malayi infective L3 JHU93SL-BmL3
217721808543R47656AS3ISB046SLBrugia malayi infective L3 JHU93SL-BmL3
4449601172342N43459AS4SLC782T3Brugia malayi L4 JHU93SL-BmL4
8810561871040AA241441MBL2SJ9A7T3Brugia malayi second stage larvae JHU96SL-BmL2
8811241871108AA241504MBL2SJ9G11T3Brugia malayi second stage larvae JHU96SL-BmL2
8986701893275AA257785MBL2SJ3B9T3Brugia malayi second stage larvae JHU96SL-BmL2
8987681893373AA257857MBL2SJ4D3T3Brugia malayi second stage larvae JHU96SL-BmL2
9214511923302AA280441SW3ICA2601SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
11888282289692AA542780MBL2SK3E01T3Brugia malayi second stage larvae JHU96SL-BmL2
12139082334990AA563525SWMFCA2480SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 1:41:20 on Sat 18 Nov 117.