CBrugiaQ_2241


Sequence

>CBrugiaQ_2241 (2 EST) Length=390 GCATGTTATCACTACCATCAATGCCAACGCCAAACATTATTTCAACAATCTAACTCCAAGCACGTTCGTTAACTCGTTTT CCCTGTTTTGTTGACTCCCTATAACTCCTAAAGATGAAATGTCTGAACCACTAGCTCCTCTTTCTCTGTCAAGTTTCTGT CGATTCACTTTCTTCTTGGCTAAACGAGCCATTTTTTTGCGTTTACAGATGGTGCTCCCATTATATGGATTACCATTAGC TTTTTCCATCGATTTCGTCTTCTCCTGCTTCAGTTCCTCTTGCAGTTGTTTCCAGTTTGCAGACAATGGCGTCATCTTGA GGAATGACAGGTCACACAGTTGTATTTGTTTAGAATTTCCGAAAAGTTATATTTTATACGTTCCTCAAAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CBrugiaQ_2241: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
6722681537215AA052037SWMFCA756SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
11161342199275AA471511MBAFCX3C12T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 10:43:49 on Sat 18 Nov 117.