CBrugiaQ_2253


Sequence

>CBrugiaQ_2253 (2 EST) Length=385 AAGAAAATGTAAGGAACAGTGCGTACGGAAAAGTCAATGAAAATAACTCAGGAGCACTATTCATGGCTGATATCAGCATA AAATGCGCTTAATGGAAAAATCTGCACTTTTACTTTTGTGAGTCACTGTACGCGACCTCAACATTCTAGTGCGATAACAG TTACATCCATATTGTACAATGATGTCGCATCCAGTGATTAGGCAAAAGGAAGGTCATTGGCACTGTAGGAGGCATCAATG AACGGATTTTATCACTGATACGTACCTATCATACATTTGTATTGACTTCATTTGTTTATTACCAGTTGACTCCTCACAAT AACTCTCGAACATGAGGTGAATTTCAATGTGCTATAATTTGTTCTTTAATAGAGAAATTACGACG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CBrugiaQ_2253: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
1435272
320224945425R86439SWAMCA346SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 9:59:12 on Fri 24 Nov 117.