CBrugiaQ_2254


Sequence

>CBrugiaQ_2254 (2 EST) Length=389 ATTTGATATCCATAAGTATAGATCCGTATGCTATCTGTTTTCGAAATACAGACATTTGGTACAGTTTGCTATCTCAGCAA TCTCATTAATTAATACCAAACTATTCCTCTGATCCATTTTGTTATCCGATTTGCTATGAGGCATTAAATTTAAGAAATCC TTCATTAGATGACGCATACGATAGGATGCACCACGAGAACAAAAAATCAGAACACGCTCACGATTTGTCCATTTTGATTT GACCTGTTCTGAAGCATCTTTTTTTTTTGGGTGAAATTGGAAATGATTCTTCCTTAGATGTATTTGAGCTCTCTGATGTT CTTGAAGTTAGTCTACGCTTCTTCGACAATAATTTATCGACACCTTCAAGTTGACGAAAACGTCGTGAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CBrugiaQ_2254: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7620681681936AA123534MBAFCE9B04T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11160562199197AA471433MBAFCX2E03T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 17:53:36 on Mon 20 Nov 117.