CBrugiaQ_2257


Sequence

>CBrugiaQ_2257 (19 EST) Length=381 CGGCACGAGGCTNGTTGCATCAGAAATTGAATTCATATATAACAACTAAATAAAGATGGGTCATCAGAATTTATGGTTTT CACATCCGCGCAAATATGGCCCAGGTTCTCGTTCATGCCGAGTTTGTTCAAATCATCATGGGTTGATTAGGAAATACGGA CTTAATATGTGTCGACGATGTTTTAGAGAGTATGCTTCCGATATTGGATTCAGAAAGCTAAATTGACGTGCAGAAAAAAT GGAGAAATACAATCGCGATATGCTTTTCTTCGCATTCTTTTGTAACATTTAATTATGATCGGTTTTTTTCTTGTTTTGTA ACGTTTCTTTTATTCTTTTGTAATGTTAACTTTTCCTTGGAATAAAGTTTAAATGTTTAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CBrugiaQ_2257: (19 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
281861890045H21350AS3ISB383SLBrugia malayi infective L3 JHU93SL-BmL3
7155661619237AA080328SW3ICA1693SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
8808691870853AA241465MBL2SJ0F1T3Brugia malayi second stage larvae JHU96SL-BmL2
8808721870856AA241468MBL2SJ0F4T3Brugia malayi second stage larvae JHU96SL-BmL2
8810441871028AA241429MBL2SJ8H2T3Brugia malayi second stage larvae JHU96SL-BmL2
8810511871035AA241436MBL2SJ8H11T3Brugia malayi second stage larvae JHU96SL-BmL2
8810711871055AA241529MBL2SJ9B12T3Brugia malayi second stage larvae JHU96SL-BmL2
8986681893273AA257783MBL2SJ3B6T3Brugia malayi second stage larvae JHU96SL-BmL2
8986841893289AA257799MBL2SJ3D2T3Brugia malayi second stage larvae JHU96SL-BmL2
8986971893302AA257527MBL2SJ3E7T3Brugia malayi second stage larvae JHU96SL-BmL2
8987441893349AA257833MBL2SJ4A11T3Brugia malayi second stage larvae JHU96SL-BmL2
8987691893374AA257858MBL2SJ4D4T3Brugia malayi second stage larvae JHU96SL-BmL2
8987871893392AA257876MBL2SJ4F10T3Brugia malayi second stage larvae JHU96SL-BmL2
8988021893407AA257632MBL2SJ4H4T3Brugia malayi second stage larvae JHU96SL-BmL2
9165021917122AA275474MBL2SK1A12T3Brugia malayi second stage larvae JHU96SL-BmL2
9165071917127AA275479MBL2SK1B06T3Brugia malayi second stage larvae JHU96SL-BmL2
9165481917168AA275520MBL2SK1H04T3Brugia malayi second stage larvae JHU96SL-BmL2
10988772168047AA454378MBAFCX0H01T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
13666702605208AA661164MB3D6V3E11T3Brugia malayi day 6 post-infection third stage larvae SAW96MLW-BmL3d6


Date: 6:13:46 on Sun 19 Nov 117.