CBrugiaQ_226


Sequence

>CBrugiaQ_226 (72 EST) Length=705 CNGGNCCATTATAANATAGTTAATTCATGTCTTCCATTTCTTTATTAAAATAATATTACATTAAAGATTTTAATAGAAAT CTGTGACACAATGTAATGTGATGTGACATATTTGATTGTCGCACATATTTCCAATATTTAATAAAATAGCGGTAAAACCA AAGTTAAATGTTATTTGTTAGAAAGAATTAAATTTGAAAAGTGTAAGAAATGGATGGAAAGTTGGTAGTATCAAAGACTG ATTCAGTCCTATGCGCATTGCCAACCTGCTTCAGGTGCACAGTACGAATACTCCAATTTACCATTGTTCGTTCTTTCGAT GACGCACGAATGCAACTTATCTTCGCAGAAGCAGCCTCTGTCAGTCCATGCCTGATTCTCGCTCAGTCTGCACCACGCTT GTGGTTCACGTTGATCGTAGCAAGCTTCGTGCGAAGAGCACTCTTTCTTTTTGCCATCAGTTTCAACAAATTCCCCTTTG GTTACATATTCATCACCTCCTTCACTACCACCTCCGTCCTCGCTGTCGTCGGTGTCATCGGCTGCGGAGTCATCGAACTC TTCGTCTGATTCTGATGCACACGGAAGTGTCACAAAAAGAATTACCAAACCGAATGCTATTAAAAGTTTATTCATTTTCT CTTCTAATTTGTCAGTCTTATTCGAAGCGGTGTTCGTGCCGAATTCCCTGCAGCCCNGGGANNNN


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CBrugiaQ_226: (72 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
217791808613R47726AS3ISB139SLBrugia malayi infective L3 JHU93SL-BmL3
281266890023H21328AS3ISB339SLBrugia malayi infective L3 JHU93SL-BmL3
291556902088H30932SW3ICA155SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
291567902099H30943SW3ICA186SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
291612902144H30988SW3ICA241SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
291623902155H30999SW3ICA265SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
320192944808R86402SW3ICA351SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
343532973936R95206SW3ICA385SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
3795481054514H77263SW3ICA476SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
3951071088244H92666SW3ICA526SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
3951111088248H92670SW3ICA530SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
3951151088252H92674SW3ICA534SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4061801118186H97301SW3ICA470SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4156331122577H98355SW3ICA508SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4351211154128N33728SW3ICA632SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4385071158256N37114SW3ICA640SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4426801164828N41230SW3ICA1071SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4427361164884N41286SW3ICA1022SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4446101167411N43106SW3ICA941SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4446231167424N43119SW3ICA954SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4447041167601N43219SW3ICA1141SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4447121167609N43227SW3ICA1149SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4447151167612N43230SW3ICA594SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4447561167653N43271SW3ICA707SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4448191167716N43196SW3ICA915SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4450241172406N43523SW3ICA874SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4450871182114N43649SW3ICA819SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4450941182121N43541SW3ICA826SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4451181182145N43565SW3ICA978SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4451931182220N43692SW3ICA722SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4458611182878N44359SW3ICA1196SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4459601182977N44458SW3ICA1323SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4706311215762N64880SW3ICA1344SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4706401215771N64889SW3ICA1354SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4809551235924N74793SW3ICA1403SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4812011237171N74862SW3ICA1440SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
5061221270749N99334TNPIBM3004Brugia malayi infective L3 JHU93SL-BmL3
5304291300179W23325SW3ICA1454SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
7155441619215AA080306SW3ICA1548SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
7155461619217AA080308SW3ICA1552SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
7272311634876AA089397SW3ICA1755SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
7272411634886AA089407SW3ICA1771SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
7272581634903AA089424SW3ICA1794SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
7496541663658AA111768SW3ICA1748SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
7496661663670AA111780SW3ICA1868SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
8390461795711AA199968SW3ICA2011SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
8428441799509AA203766SW3ICA2041SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
8640351845483AA224699SW3ICA2030SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
8640531845501AA224717SW3ICA2147SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
8640621845510AA224726SW3ICA2174SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
8640631845511AA224727SW3ICA2176SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
8865181878430AA247101SW3ICA2206SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
8962911889971AA255368SW3ICA2403SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
9076621902767AA266679SW3ICA2365SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
9139491911873AA272946SW3ICA2378SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
9139501911874AA272947SW3ICA2380SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
9139651911889AA272962SW3ICA2457SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
9141301912500AA273126SW3ICA2104SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
9141721912542AA273168SW3ICA2596SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
9245691926171AA283477SW3ICA2116SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
9245761926178AA283484SW3ICA2123SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
9246151926217AA283523SW3ICA2650SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
9246681927238AA283580SW3ICA2736SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
10777262130909AA433432SW3ICA2667SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
10777352130918AA433441SW3ICA2065SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
10859942153578AA441700SW3ICA2514SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
10860042153588AA441710SW3ICA2528SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
10860182153602AA441724SW3ICA2545SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
13667352605273AA661229MB3D6V4D07T3Brugia malayi day 6 post-infection third stage larvae SAW96MLW-BmL3d6
13668412605379AA661335MB3D6V5G08T3Brugia malayi day 6 post-infection third stage larvae SAW96MLW-BmL3d6
13668482605386AA661342MB3D6V5H04T3Brugia malayi day 6 post-infection third stage larvae SAW96MLW-BmL3d6
13870492662989AA680984SW3ICA2679SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 23:59:30 on Sat 18 Nov 117.