CBrugiaQ_2265


Sequence

>CBrugiaQ_2265 (2 EST) Length=733 GGGATGCGATGCTTGCTGTACACGTGGTGGTGCTATCACCAAAGAACCTTTAGAGGTTGCTTCTTTCAGAAATGCTGGCA AGCTAGAAACTGCAGTACCTAAATCTACTAATGCCATAATTGTATCTGATGGTGTTGAAATAGTACGACCAGCATGTTCG GTCATTTGACGTGTGGTAACGGCCAGTTCATTGATATATGAATTAATCATATGGGTGAGTAATTCGAGAACATCAGCTTC AATCGTTTCGAAACCGGCCTGTTTACAGATAGCAGCAACCGCTTGACGTAATACACGTCGATACACGTAATCAGCTACTG TTGGCGAATAACTTGTTGATGGCAGAGAATGCATTACTGTGGCTCGTGCCGAATTCGGCACGAGGTTGCACAGATGATAT GGTAAATCAGCACAAACAGAAGACTTATGTGGCTTGATAGGGAGCAGTTATCTGTGAGGCACTTTGGACACAGAATACCG GAAGATATTGCCAAACCTGATATCCCATTCACAAAAGGAAAAAACGGTATCGTAAAAATCATTTTATCTACCATCCAAAA ACAACTTTTGTGGATCGTATCATTTTGTGAGAAGTTGTAAATGTTGTTTGTTCAATTGTTATAAAATTTGAAATCTGCAC TTTCTGAATCATTCTGGAAGTTATCATTTTAAAAAAAGTATGGTTCANCGAAAAATCATCATTAAAAAGAATTGGAATAA AAAAATTAATGTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CBrugiaQ_2265: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8983161892921AA257445MBAFCZ0A7T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11162792199420AA471656MBAFCX5A12T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 2:23:42 on Mon 20 Nov 117.