CBrugiaQ_2278


Sequence

>CBrugiaQ_2278 (3 EST) Length=383 TACCCAAGTTTGAGATGAAGTTTTGTGATGAGAGATTGTTTCTGAAGCTAGAATCTTTGATCAATGAAAACAGGACATGA ACAGTAGAAGCAATGCAAACCTCTCTCGATCTTAAAATGGATAGTCTTATTCAGAACGTTCGATCAAGAACTGCCGACAA TTTTAAGGTATTCGAAAATGTGTTAATGGTATAGGGATCCTACCATTGCTGGTAGCTACCACCATGTTTTAAATCGATTA CAAACAACTTTAACAGGTAAAGCAGGAGAATAATGCGTTGGTATTATTTGCTAGATATAAAAATTTAGCGAGTGTGCATG GTAAATATTGTGCATTATAACATAAGGATCATAACTTTACTAAAAAAAAAAAAAAAAAAAGAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CBrugiaQ_2278: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
1435312
281228889985H21290AS3ISB172SLBrugia malayi infective L3 JHU93SL-BmL3
4449991172381N43498AS4SLC869T3Brugia malayi L4 JHU93SL-BmL4


Date: 17:13:46 on Fri 24 Nov 117.