CBrugiaQ_2283


Sequence

>CBrugiaQ_2283 (2 EST) Length=397 CGGCACGAGGATCGCTTAAGGTCGCTGGGAGGTGTGCTTTTGGGGATACCATGGAAATCTCGGGGGATGGAAGATGACAC CAATGAAGGAGATTTGGTTCATAGAATAACACGAGAAGAATACGAGGAACCAATTCGGGATGCCTACGTGGAGTCACTGG CACGTATGTCATATGCAGAACTTGATGACAAATACAACCCAGGTATTCAGGTCCAACATCGCCAGATGGAAGTGTGAACT TTGAGTGTCACTGTGTTGGTCACTTAGTCGCCAGCCCATGCGGTCATGAATTTCGTGAAGCAATAAAGTGCCAGAAAAGT GCTGGGGAAGCAGCCTTAGAGGAAGGAGCTTGTCCNCACAGAGTCCATGAATTTTATGAATTGNGTCATGCGACCAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, Processing,


Cluster Information for CBrugiaQ_2283: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5061191270746N99331SWAMCA556SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
11539042247118AA509241MBAFCX9A01T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 16:17:30 on Sun 19 Nov 117.