CBrugiaQ_2285


Sequence

>CBrugiaQ_2285 (2 EST) Length=394 GCGATATTCANACTAACGATACCCATATTATAGATGTCATTGATGTATTCTTTTGGAATTTGATAATTCGTCCACAATCC TACATTTCGGATCGATAACACCATCATTACAGCTATGAGTAATGCGCAAATAAGGCTCAATACTGCCTATTTCTTCTTCC TGTCCACTCACTTCAAAGCGTCCGTTTCGATCGGAATGAGTTGCAGAAAGTGAATCATCAGGGTCCCATGTATCCACTTC ACGTTAATTCAATATGAACATTAATAGCCGAGTTATCACTGCATGCCACTTGTCCTCTTACTGTCACTGTTTGCATTTTG CAGTATGCAAACGCTACCAATGAACAGTGTAAATCCTGTTACTTATAATATTAACATTTTTAATCTCAAACTTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST, Processing,


Cluster Information for CBrugiaQ_2285: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4351121154119N33719SW3ICA621SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
8986821893287AA257797MBL2SJ3C12T3Brugia malayi second stage larvae JHU96SL-BmL2


Date: 21:9:25 on Fri 24 Nov 117.