CBrugiaQ_2298


Sequence

>CBrugiaQ_2298 (3 EST) Length=626 CCCATAACGACTAATAACAGCACTGTTTTTACAAAATGTGTGAATAAGAGGTTCACTAAATGCAACTGCTACATCGTTTT CATCATATTTCATCATATTCGAAACAATGTGTATATTATTTGGAAATCTGCCAAGCTCTTTCCGCAAAAAAAAATCAATC ACGTTTCCTATACCAGCAGAAAAAATAATTAAAGGCACGTTATGATCACGCAACATTAGCATTAACTCCTCTGCTCCTTC CTTTAATTCGAGTTTTGCTTCAGCAACAAATTTTTGGATCATTTTCTTCGTAAAACCAGTTTTGATGATGTGTTCGTGAG AAGTTCTCCACCAGTCTTCCATGTGAGGAATTTTTTCAGCAACTGTTATGTGTGGATCAAACTCAATTGGGAGATATTTC TCCTTCAGTCTTTCGAGAATCATACCAAGCTCTTGCGACACTGTCCATGCAGCGCTATCAAAAACGCCATGTGTTGTTAA ACAACTTTTACCTTCAGGGTCGTGGAAACGTGATAACGTATAATCAAAATCTGAGACCACCAAAAGTTTATCCTTGTCAG CACTGATAATCTGGTTAAGTTTCTGTTCTACGGCAGACGAGTCGCGCATGCGCACCTTTTCACTGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CBrugiaQ_2298: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8983461892951AA257475MBAFCZ0D6T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8985871893192AA257715MBAFCZ3B9T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
10480682064715AA406749MBAFCZ3B09T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 23:2:57 on Fri 24 Nov 117.