CBrugiaQ_2306


Sequence

>CBrugiaQ_2306 (6 EST) Length=426 GTTTCACGCCCTCTTGAACTCTCTCTTCAAAGTTCTTTGCAACTTTCCCTCACGGAATGCCACAAATGCTATCGGTCTCA TGAAGTAGTATTTAGCCTTAGATGAGGTTTACCACCCTCTTTGGGCTGCAATCTCAAACAACCCGACTCNAAGGAATAAC CTACCGTAACTTTTTTCACCCGTACAGGTCTAGCACCTTCTATGGACTGTAGCCCCGCTCAAGGGGACTTTGGGTGTAAA AATATGTTACGGATAGTTATACCTATACGCTACATTTCCATATAGCCATATAATGTCTATCGGATTCAGCGTTGGGCTTT TTCCTTTTCACTCGCCGTTACTAAGGAAATCCTCGTTAGTTTCTTTTCCTCCGCTTAGTTATATGCTTAAATTCAGCGGG TAATCACGACTGAGCCCGGGGGATCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST, Processing,


Cluster Information for CBrugiaQ_2306: (6 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
320233945434R86407SWAMCA357SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
8679461850711AA228618RRAMCA325SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
10480382064685AA406693MBAFCZ2H02T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11939382315090AA547889MB3D6V2D04T3Brugia malayi day 6 post-infection third stage larvae SAW96MLW-BmL3d6
13667252605263AA661219MB3D6V4C06T3Brugia malayi day 6 post-infection third stage larvae SAW96MLW-BmL3d6
13667752605313AA661269MB3D6V4H08T3Brugia malayi day 6 post-infection third stage larvae SAW96MLW-BmL3d6


Date: 8:22:44 on Fri 24 Nov 117.