CBrugiaQ_2307


Sequence

>CBrugiaQ_2307 (4 EST) Length=418 AAAAATCTGCAGTAAGTAGATAGAGGAAGAATATGGCGCAATCGGTTCCACCTGGTGATATCAACACCCAACCCAGCTCT AAAATTGTATTTAATGCACCTTATGACGATAAGCATACTTATCATATTAAGATTACTAATGCCGGTGGTCGGTCGCATTG GTTGGGCTATTAAAACGACCAATATGCGCCGTCTAGGTGTTGACCCACCATGTGGCGTCCTGGACCCAAAGGAGAATGTT CTCATGGCGGTCTCGTGTGAAACATTTGGACGCAGCAGAGAAGACATCAANANCGATCGNTTTACCACCGAATAGAAACC AAAACCGGATGGCGCTGCGAAACAGTTCCGGCCCAGGAATGGTCCAGGGGATGAATGGCCCGCGAAGATTGGCCCCGATA AATTTGGGGAGGGGGGGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST, Processing,


Cluster Information for CBrugiaQ_2307: (4 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5014611266982N94701RRAMCA1173SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
5477111322265W39859RRAMCA171SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
5800911382092W59878SWAMCA755SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
7159241620781AA080686RRAMCA236SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 16:16:46 on Tue 21 Nov 117.