CBrugiaQ_2308


Sequence

>CBrugiaQ_2308 (20 EST) Length=636 TTATTAGATTTTGAATCATTTCCAAATTTTCACCGATCACAGCTTGCTGTGCAGAGGTAAGCGTCAGTGACTTAGCATCA GGATTTTCATTACTTCCATTTGCTTGAATTGTTCCACTAGTGAGTGCTTTGTAGAGAACATCGGCGATCACGTTTACGGA TGGAATTGGGCTAATCTCACCCCCAATCAAATTACCAACCGCTTTCGTTAAACCTCGTGTGTCAGGTTCAAGCTTACTCT TTTTGCTGTTCAAACCGATTAAACTAATTATTGTACCAATTAGGCCACCAGATGATGAAGAATCGTCCGTTAATGCACCA TATTGATCATTTTCGATGCCTTCATCAATACTATCTTTCTCGTGCCGAATTGGCACGAGCAAAAAAAAACAAAACAAAAA AGCGCCATCGAAAGGTAGAACATTACTAACAATAACAAAACGGCGCATTATGAACTAACAGCACAAAAAAGGAGAAAACC CCTCCAAAAAAAAGACAAAAAAAAGAAAAGAAAGAAAACCCCNNAAAAAAGAGAAAAAAAAGAAAAAACCCCCANTAAAA AGAGAAAAAAAGAAATTCTANAAAAAGAGAAAAAATTCTAAAAAAATGAGAAAAAAAATCCGAAAAAAGAAAATCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CBrugiaQ_2308: (20 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7471611660771AA109287MBAFCE0B11T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
7472491660859AA109389MBAFCE1D05T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
7523821668366AA114518MBAFCE5G01T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
7619531681821AA123650MBAFCE7B07T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
7620631681931AA123529MBAFCE9A07T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8002721737655AA161625MBAFCF7D05T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8002851737668AA161638MBAFCG0A11T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8002931737676AA161646MBAFCG0B09T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8003111737694AA161664MBAFCG0D09T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8196181763799AA180607MBAFCG1A07T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8196481763829AA180637MBAFCG1D09T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8197271763908AA180690MBAFCG3C09T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8197391763920AA180702MBAFCG3E02T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11161022199243AA471479MBAFCX3A01T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11536252246839AA508962MBAFCW1F10T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11537892247003AA509126MBAFCX7F02T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11538012247015AA509138MBAFCX7G02T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11539312247145AA509268MBAFCX9C07T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
13813432655463AA675757MBAFCW4D08T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
13814302655550AA675844MBAFCW5E03T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 17:55:27 on Fri 17 Nov 117.