CBrugiaQ_2309


Sequence

>CBrugiaQ_2309 (7 EST) Length=468 GAGAGAGTTTAGATTATACTTTCTGATAAACAAATTTCAAGAGACAAAGTGGAAAACCACATGAATGAATCAAATATATG CGAATAACTATTTTACAATTTATGCATTTTCCATAATTTTTTTGGCCGGAATATTTATGATCAAATAAGAAATAAAGATT CTTAAACATAAGTTGACAATGACAACAACAAACTACACTTCATAACCATACTGTCTCATGCACTTCTTGTGAGCTTCTAT CAATTCACCGCAATGTTCTTCACCGAACAAAATCATACATTCATCTCTAGCCTTTTTAGTTTCTGGACAAGCGCAGCACG GCTTGGGCTTTTTCAAGTCATTATCTTTCGACGATATCAAACAACCCTCACCGTCACTCATCTCAAACTTGGGTAATTAA ACCCGGAATTCTTCGCGATAATTATCACTGTTACTACTATATCACAGTATTTCCCGTTTATTGTTCTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CBrugiaQ_2309: (7 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5594301345251W51637AS4SLC615T3Brugia malayi L4 JHU93SL-BmL4
5595031345324W51622AS4SLC890T3Brugia malayi L4 JHU93SL-BmL4
5595061345327W51625AS4SL895T3Brugia malayi L4 JHU93SL-BmL4
8809761870960AA241655MBL2SJ8A7T3Brugia malayi second stage larvae JHU96SL-BmL2
8987671893372AA257856MBL2SJ4D2T3Brugia malayi second stage larvae JHU96SL-BmL2
9165141917134AA275486MBL2SK1C08T3Brugia malayi second stage larvae JHU96SL-BmL2
13247592539402AA627015MBAFCW2E05T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 21:42:59 on Fri 17 Nov 117.