CBrugiaQ_2324


Sequence

>CBrugiaQ_2324 (2 EST) Length=400 CCAATCTTGCAAGTGTTGAGGTAAAATTGCACTATTTGGACAAAATGTATCAGGTGACGATGTCCGTCCACCAGCTAGCA ATTTTGTTGTGTTTTGAGACGAGGGATTCGGTAACTTTAAGTTATATCGAGAAAGCAACTGGTTTATCAGATGAATTACT TAGCCGAAATGCTCGTGCACTGGTTGATTCTGGTATTCTAATTATGGTGAAAAAGGAAATGAATGAGGCTAATGAAGTCG CACTCAACTTGTCACTGACATCGAAACGTCTTCGGTTTAAAGAAAAGGTGCCACAATTACAGCGACATGCAGAAAAGGAG GCAGAGCATGTAAATATCACTGCTCAACAGGATCGGAATATATATATATGGAATGTACTATGTCGCATATGAAACGCGAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CBrugiaQ_2324: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8002091737592AA161582MBAFCF1D11T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
10751872113664AA430868RRAMCA385SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 20:41:40 on Thu 23 Nov 117.