CBrugiaQ_2326


Sequence

>CBrugiaQ_2326 (14 EST) Length=385 GAGCGGTCTATGACCAGAGTTTGAGATTATCAAGTTNAATTATGATATTATCAATATTTACTACTTTATATATCATATTA ATTGCACAAGGAGTTCAAGCATGGTGGTATCAACCAGTTGGTTATGGTTTGGGTTATCATCATGCTTCTTGGTATCATCC TTATCCTGCTTTGGGTCCAATGCCATATTATCAGCCTCATCCTTATCATCCTTATCACTATGCTGATATTCATCACATGT ATTCTGCACATAAAGGTGCACAAATTGGTGCTGCACTTGGTTCATTGGCTGCAAATCTTGGTAGGAAGAAGTGAAATTCG TGAAATCATTTATTTTTTTCTCATTTTATGCTTATTTTAATTCTGTGTTCAAATAACCCCCCCAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST, Processing,


Cluster Information for CBrugiaQ_2326: (14 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
217669808491R47604AS3ISA027SLBrugia malayi infective L3 JHU93SL-BmL3
217684808506R47619AS3ISB014SLBrugia malayi infective L3 JHU93SL-BmL3
217720808542R47655AS3ISB051SLBrugia malayi infective L3 JHU93SL-BmL3
217723808545R47658AS3ISB041SLBrugia malayi infective L3 JHU93SL-BmL3
273953878859H14039AS3ISB381SLBrugia malayi infective L3 JHU93SL-BmL3
276417881983H16479AS3ISB270SLBrugia malayi infective L3 JHU93SL-BmL3
276421881987H16483AS3ISB278SLBrugia malayi infective L3 JHU93SL-BmL3
276426881992H16488AS3ISB298SLBrugia malayi infective L3 JHU93SL-BmL3
281222889979H21284AS3ISB246SLBrugia malayi infective L3 JHU93SL-BmL3
281249890006H21311AS3ISB244SLBrugia malayi infective L3 JHU93SL-BmL3
354108992882H52886SW3ICA430SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
3644631017390H63044AS3ISB081T3Brugia malayi infective L3 JHU93SL-BmL3
3644681017395H63049AS3ISB084T3Brugia malayi infective L3 JHU93SL-BmL3
7272261634871AA089392SW3ICA1598SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 23:19:22 on Sun 19 Nov 117.