CBrugiaQ_2328


Sequence

>CBrugiaQ_2328 (3 EST) Length=494 GTCGACTGGAGCAGATGGACACCAGGTGAACCTGGACCGAAAGGACACCAGGGCCAGATGGAGATCCCGGACCACCAGGA CCACCAGGAGATGCCGGACCGAGTGCGCCAAGCGAACCTCTCATTCCCGGAGAACCTGGACCTCCTGGAGACGCAGGACC ACAAGGACCACCTGGATCACCAGGCCGACCAGGCAGCGATGGTGCACCAGGTCCAATCTGGACCAAAGGGACCACAAGGA CCAGATGGCCAACCAGGACCAGACGGTGCACCAGGATCAACCAGGACCACCAGGACCACCAGGAAGCCCGGGTGAAAAAG GAATCTGTCCGAAAGTATTGTGCCATTGATGGTGGTGTATTNTTCGAAGACGGTACTCGTCGTTAAGTGGATTGTTAGAA TGTATCACTCGAAGTCCTCATCCTTACATCAGACTGCCATTTTGCCGATTTATCACACAGTTATATCAACAACAACCAAA TAAAATTTTCACCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CBrugiaQ_2328: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4809571235926N74795SW3ICA1405SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
11536282246842AA508965MBAFCW1G01T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
13667662605304AA661260MB3D6V4G07T3Brugia malayi day 6 post-infection third stage larvae SAW96MLW-BmL3d6


Date: 14:40:39 on Sun 19 Nov 117.