CBrugiaQ_2335


Sequence

>CBrugiaQ_2335 (2 EST) Length=381 GTGTGTTAAAGTTTGAAAACGTGAATATATAAAGAATGGTACAACATAATCTAAAGAAGAAAGTATCATTACCAGGTGGA GTAAAGCAGTAAGAGAAAAATTGAAAACTGCAAACACAACGTCCCAAGAAAGGTCAGCAATGGATAATCGCTCCAAAGAA GCCTGCTGCAATACAGCAAGCTAAAATTGATACAGAGATAACGCGAACAATAAACGACAAAAATGAACAGTTGCTAAAAG GTCGCGCGAATAAAGATGTTGGTCGAACTACTACTTCTACCTAATGTGTCCATTATAATTATTTCAATTCATTAATTGTA GTGTTAATTAATTCTAAACTGAATATATAACACTTAATTTTGATAAAAGTCAAATGAAAAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CBrugiaQ_2335: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4809341235903N74772SW3ICA1376SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
8810221871006AA241701MBL2SJ8E11T3Brugia malayi second stage larvae JHU96SL-BmL2


Date: 16:31:15 on Sun 19 Nov 117.