CBrugiaQ_2337


Sequence

>CBrugiaQ_2337 (3 EST) Length=377 AAATCATGAAATATTTTATTCTTATGCTAATAGTTTTTACTGCATTTAGTGCAACCATCGCTGACGATGAAACAGATGAA GCAGAAAAAGAGCCGGAAGAAAAAAATGAAAAAACTGAGACCGAAGATCGCAAAGAACGAAGTGTGCTAACAAATTATGA TCCAGCGATAATGGCACCAGAAATGAACGCCGATGCTGGTTTACTCTTTCGACGTAAAATACGATCGGAAGAAGGATGTT GCTGTTGTTGAATGAAAAAAGAAAAAATATAAATAAATGAATTAGATAACATTAAAAAAGATTTTGAATTCTGAATGAAT TTTGAGTATTTCCACATTCATCACTGTATCAATAATGAATAAATTAAATTCACTTTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CBrugiaQ_2337: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4425261164674N41076SWMFCA308SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
8675301849760AA228202SWMFCA1127SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
9214891923340AA280479SWMFCA2141SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 1:43:26 on Sun 19 Nov 117.