CBrugiaQ_2346


Sequence

>CBrugiaQ_2346 (4 EST) Length=723 ACGACGACCCCGGTAAGGAGAGCTTCGAGAACGGAGAACAGTCAGGCGACGACTACGTGAACGAGAACGGCGTGATTTAC GTGGACTTGATCTACGTAGTCTTGACCTTGACCTGCGTGGAGTTGATCGTTTGCTTTCGCTATCTGTCATTCGATACAGC CTATATAGCATACTCGAAGGAGTACGATAGCGACGGCTACGCTGATACGCTCGCACAAGTGATCGTGAACTATATCGCGT ATAACGCTTTTTCACAGCACTACGTGACCGACTTCCACGAGTTCTTGACCGGAACCGTGAGCGTAAGCCGTGACATGGCA TATCTGATTTACCCCAGTTAGACACTATCAGTTTGAAGAGAAATTTCCACAGGAAAGATGACACTATCAGTTTGAAGAGA TTTTTTCCACAGGAAAGTAGTAGAGGGAAAGGAATGAAATTTGGGTAAAGTCAGGGTAGGGAAAGAAGTAGTAGTACTTG GGTAAAGTTAAGATTGGAAAAGGTTGGAAACTGGAGTCAAGTAATGGAGAGAATTCGAGGAAAGCGGCACGAGCTCGTGC CGGAATTCGGCACGAGATTATTCGATTGTTTGGTCTTCGTCGGTTCCGCAATTGTTTTCATATTTTGATGAGAAGCATAT GCAGTTTCCGAATGTTGCGTTTGAGTGTTTTTTGCTCTCTGTGCAAATTTTGATAGTTACGATAAAAGTTTCGAACTGGG GTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CBrugiaQ_2346: (4 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5477031322257W39855RRAMCA143SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
5801041382105W59891SWAMCA769SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
6806741547237AA054903SWAMCA1490SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
7472771660887AA109417MBAFCE1G05T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 18:0:14 on Fri 17 Nov 117.