CBrugiaQ_237


Sequence

>CBrugiaQ_237 (2 EST) Length=657 ATTATATATTAATCATCAGATCGAGAAATGCAGAGGATTGGCGGAAAGCGATGTCGAGGGACGTTATGAGGTCTATAAGA AGGCTGTTTCAATGAATTCTCATGCAGCCACTCCAAAAAGAGTTCCTCTTTATTTCCTCCGCGGTGTCCAGTTTGAAAGT TTATTGTTCAATTATTTGATAGCCGGTCTTCGAAAAGGCGTGCCTTCACTTTTCAAATATCTTATCCCGCTTTATGTAGA CAGCGATAAGGTCCAATTTTTGGAGCGTACGCTCATCGAATTCGTTAAACGGTTAGGGGAAAACGGGTATAAGAAAGGAT CTTTGGACAATAGTCCTCTTCCGGAATCACCAACGACGGTATTATGGTTGTATTACTTATTAGCTCAACATTATGACAAA TTAGGTTCGGTTCAGCAGGCACTTGTATATATTGATAGAGCAATACAGCATACACCAACACTGATTGAACTCTACATGAT AAAAGCAAAAATCCATAAGCACTCAGGTGATGCACATGAAGGTGCAAGCTTAATGGAGCAAGCGCAGTCTTTGGGATACA GCAGATCGCTATGTGAATAAGTAAATGTGCCAAGTACATGCTCCAGAACTGGGCTCCATTAAAGAAGCAGAAAATATGTG CTCGAAATTTACCAAGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CBrugiaQ_237: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8679221850687AA228587SWMFCA1282SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
8713481855004AA231963SWMFCA1357SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 18:44:19 on Sat 18 Nov 117.