CBrugiaQ_2373


Sequence

>CBrugiaQ_2373 (96 EST) Length=407 GTCAGATCCTGTCTTTTCGTATCTATAGGTTTTCCCATAGGAATTGTAACACCATCTTCTGTCACAAAGTACTCATTTGG ATCAGGAATCGNTTGTCCTAAACCTTTAACACTATGCTTTCCTTTATCAGGTTTTATGATTGACTTNGCATTGATCTCTT CTNGCATTTCTCCTCGTGCCGAATTCGGCACGAGTATACCCTTTCACCGGCTGTAAGTAAGGTGCGCGGTTATCGCTATC AGTTCTGCTCGGTGTATGTGAATGTTCACTTTCTGCATACAAAAAAATCGAATAAAATTACAAAAATTCCCCCCAAAAAA ATAGTAAAAATATGAAAAAAATGTACCAAAAAAAATGACAAAAGTAGAAAAATTAAACAAAAAAATGACAAAAAATTAAA ACTTCAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST, Processing,


Cluster Information for CBrugiaQ_2373: (96 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7159321620789AA080694RRAMCA258SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
7244651631375AA088148SWAFCA010SKBrugia malayi adult female cDNA (SAW96MLW-BmAF)
7244721631382AA088155SWAFCA018SKBrugia malayi adult female cDNA (SAW96MLW-BmAF)
7471691660779AA109322MBAFCE0C12T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
7471811660791AA109334MBAFCE0E05T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
7472151660825AA109355MBAFCE1A01T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
7472461660856AA109386MBAFCE1D01T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
7472641660874AA109404MBAFCE1E12T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
7497161663806AA111830MBAFCE2H12T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
7522561668240AA114370MBAFCE3A01T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
7523611668345AA114510MBAFCE5D09T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
7566491673274AA118225MBAFCE6F11T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
7566651673290AA118241MBAFCE6H11T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
7620091681877AA123566MBAFCE7H10T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
7620101681878AA123567MBAFCE7H11T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
7620141681882AA123571MBAFCE8A05T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
7620291681897AA123586MBAFCE8B12T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
7620551681923AA123632MBAFCE8E10T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8001751737558AA161548MBAFCE9H08T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8002051737588AA161578MBAFCF1D06T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8002081737591AA161581MBAFCF1D10T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8002311737614AA161688MBAFCF1G08T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8002461737629AA161745MBAFCF7A05T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8002621737645AA161609MBAFCF7C02T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8002631737646AA161610MBAFCF7C03T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8002691737652AA161622MBAFCF7D01T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8002731737656AA161626MBAFCF7D06T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8002971737680AA161650MBAFCG0C01T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8002991737682AA161652MBAFCG0C04T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8003241737707AA161677MBAFCG0F05T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8003431737726AA161547MBAFCG0H06T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8003491737732AA161618MBAFCG0H12T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8196211763802AA180610MBAFCG1A10T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8196251763806AA180614MBAFCG1B04T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8196391763820AA180628MBAFCG1C09T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8196421763823AA180631MBAFCG1C12T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8196451763826AA180634MBAFCG1D03T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8196641763845AA180653MBAFCG1F04T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8196681763849AA180657MBAFCG1F12T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8196731763854AA180662MBAFCG2D10T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8196771763858AA180562MBAFCG2E02T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8196821763863AA180567MBAFCG2E08T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8196901763871AA180588MBAFCG2F07T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8196921763873AA180590MBAFCG2F11T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8196971763878AA180595MBAFCG2G06T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8197031763884AA180666MBAFCG2H05T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8197051763886AA180668MBAFCG2H11T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8197161763897AA180679MBAFCG3B02T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8197221763903AA180685MBAFCG3B12T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8197331763914AA180696MBAFCG3D04T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8197401763921AA180703MBAFCG3E04T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8197451763926AA180708MBAFCG3F05T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8197461763927AA180709MBAFCG3F06T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8197571763938AA180720MBAFCG3G08T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8197611763942AA180724MBAFCG3H03T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8983691892974AA257498MBAFCZ0F8T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8984091893014AA257512MBAFCZ1B4T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8984351893040AA257564MBAFCZ1D8T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8984671893072AA257596MBAFCZ1G5T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8985001893105AA257538MBAFCZ2B7T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8985401893145AA257668MBAFCZ2F9T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8985981893203AA257441MBAFCZ3C10T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
10480212064668AA406676MBAFCZ2F09T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
10480792064726AA406760MBAFCZ4A09T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
10480822064729AA406763MBAFCZ4A12T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
10480902064737AA406771MBAFCZ4B11T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
10480952064742AA406776MBAFCZ4C04T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
10482872064934AA406942MBAFCZ7B05T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
10482912064938AA406946MBAFCZ7B09T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
10482932064940AA406948MBAFCZ7B11T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
10483382064985AA406902MBAFCZ7G01T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11160152199156AA471392MBAFCX2A05T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11161722199313AA471549MBAFCX3G05T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11162262199367AA471603MBAFCX4D09T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11162512199392AA471628MBAFCX4G03T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11162842199425AA471661MBAFCX5B05T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11162902199431AA471667MBAFCX5B11T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11163262199467AA471703MBAFCX5F03T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11163322199473AA471709MBAFCX5F09T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11538962247110AA509233MBAFCX8H05T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11539352247149AA509272MBAFCX9D01T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11539802247194AA509317MBAFCX9H04T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
13247142539357AA626970MBAFCW2A06T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
13247342539377AA626990MBAFCW2C03T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
13247462539389AA627002MBAFCW2D03T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
13247572539400AA627013MBAFCW2E03T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
13247702539413AA627026MBAFCW2F08T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
13247882539431AA627044MBAFCW2H04T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
13668752605413AA661369MBAFCW3B12T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
13669102605448AA661404MBAFCW3F03T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
13669122605450AA661406MBAFCW3F05T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
13669292605467AA661423MBAFCW3G12T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
13669382605476AA661432MBAFCW3H11T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
13813232655443AA675737MBAFCW4B10T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
13813892655509AA675803MBAFCW5A05T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
13814152655535AA675829MBAFCW5C09T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 9:7:48 on Tue 21 Nov 117.