CBrugiaQ_2389


Sequence

>CBrugiaQ_2389 (29 EST) Length=357 ACCCAAGTTTGAGGATTTTCCGAAATGCCTCGGCAAATAACAGAAATCAAGGAGTTTCTGATGACTGCTCGAAGGAAGGA TGCCAAATCGGTAAAAATTAAGAAAAATCCGGATAATGTGAAATTCAAGGTGCGATGTAGCAAATATCTCTACACACTCG TCATTCAGGATAAAGAAAAGGCTGAAAAATTGAAGCAATCGTTGCCACCTGGCCTTCAAGTAAAAGAATTGAAATAATAG ATGTTATTCCAATTACGATATCTGCCATTGATTTTGGTTGCATGTGGTGTGTTAATTTCGATTGCTATATGGTTTACATT GGAAGTCTAAATAAACAGATCTTTTGAATCCNNNAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CBrugiaQ_2389: (29 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4448741172256N43373AS4SLC451T3Brugia malayi L4 JHU93SL-BmL4
4448751172257N43374AS4SLC452T3Brugia malayi L4 JHU93SL-BmL4
4448941172276N43393AS4SLC469T3Brugia malayi L4 JHU93SL-BmL4
4448951172277N43394AS4SLC519T3Brugia malayi L4 JHU93SL-BmL4
4449281172310N43427AS4SLC550T3Brugia malayi L4 JHU93SL-BmL4
4449721172354N43471AS4SLC822T3Brugia malayi L4 JHU93SL-BmL4
4449771172359N43476AS4SLC814T3Brugia malayi L4 JHU93SL-BmL4
4576441193281N52115KJ4SLB177T3JHU93SL-BmL4 (JHU)
5594561345277W51564AS4SLC734T3Brugia malayi L4 JHU93SL-BmL4
5594651345286W51573AS4SLC759T3Brugia malayi L4 JHU93SL-BmL4
5594771345298W51585AS4SLC781T3Brugia malayi L4 JHU93SL-BmL4
5596581349164W51736SWAMCA633SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
8558251817228AA216512MB2SLJ1B01T3Brugia malayi second stage larvae JHU96SL-BmL2
8712811854353AA231939AS3ISB106T3Brugia malayi infective L3 JHU93SL-BmL3
8712911854363AA231949AS3ISB012T3Brugia malayi infective L3 JHU93SL-BmL3
8809151870899AA241607MBL2SJ2B4T3Brugia malayi second stage larvae JHU96SL-BmL2
8809341870918AA241626MBL2SJ2D3T3Brugia malayi second stage larvae JHU96SL-BmL2
8809931870977AA241711MBL2SJ8C5T3Brugia malayi second stage larvae JHU96SL-BmL2
8981841892789AA257267MB4SLM1B11T3Brugia malayi L4 JHU93SL-BmL4
8981851892790AA257268MB4SLM1B12T3Brugia malayi L4 JHU93SL-BmL4
8981901892795AA257293MB4SLM1C6T3Brugia malayi L4 JHU93SL-BmL4
8982141892819AA257343MB4SLM1F5T3Brugia malayi L4 JHU93SL-BmL4
8982241892829AA257353MB4SLM1G7T3Brugia malayi L4 JHU93SL-BmL4
8985081893113AA257546MBAFCZ2C9T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8987891893394AA257878MBL2SJ4F12T3Brugia malayi second stage larvae JHU96SL-BmL2
10481762064823AA406844MBAFCZ5G08T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
10777402130923AA433446SW3ICA2225SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
11163342199475AA471711MBAFCX5F11T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
13667542605292AA661248MB3D6V4F04T3Brugia malayi day 6 post-infection third stage larvae SAW96MLW-BmL3d6


Date: 22:14:23 on Sat 18 Nov 117.