CBrugiaQ_240


Sequence

>CBrugiaQ_240 (2 EST) Length=936 CCCTATTTCTGGCAATATTTTTGCCGATAACCGACCACCGTTTCCAAATGTACCTTGTATTTTATCGCCAGTTCAAGCGT TCGCTGCCACGGAAACAAAGAAATATTGAGCATTATAGCATGGAAGATATGTCCGTTTTGCAACAAGCATAGCATCTGCA TCTTTAAAATTTTTTGGTAAAAGCAGTCATCATTACCAATCGAACTTCATTACTTTGTTCTGCTCTCAAATGTGATAAAA ATTTCACCTTTTCGATCTCGTCAAGAGCGGTATATGCAATTTCAGCCGCGTAAAAATTTTTTGCATCGGTAGCAATCACC GCAAGCATTCCCCATAAATAGCTCTCCCGCATGTGTCGACATAGGCGAATTGCTTGATCCCATTTATTAGCACTAACAGA TGCGTTCAAAATAGATGCAAATGGCGTTATAGTGCAAGGTATGAGTGCGCCATCAGAACGTCTTATTGATATGTGACTGC CAACAAAGTTGTATAAATAAGCAGACTTCCCAAAATCGTTCTCATCGTCTTCAAACATTGTTTTTTGGAGTAAATCACGA TCGATAAAGACAGTAGCTGGAAATAACCATACAACAAGACGATTGTCTTGCAAACCAGCAAGCATATTAGTTTGATCGTT AAAAAGAATATTTGATCACCATCGCACCAATTTTGGCAATTTTTCGAAAAATGCCGTAAGTATTTACAACTGCTAGAAAA CAATCTAAGCATTTATCTATAAATGCTAATTTTCGATTATTCACGGATCCACACTGATCCATCACTATTTCGATTATATC ATTAGTATGTACAAGTTTTCCATTGCCAGCACCCTTTCCAGTGAGTGTTTCAAAAAAGTATACAGTCTTCAAATCCGTTC GATCCCGAATAGCTATTGTATCATAAGAAATAGCCTCCCGCCGAATTCGGCACGAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CBrugiaQ_240: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7473531660963AA109467MBAFCE2G02T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8713161854972AA232009SWMFCA1320SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 19:41:41 on Fri 17 Nov 117.