CBrugiaQ_2426


Sequence

>CBrugiaQ_2426 (47 EST) Length=967 CGAGATAAAATTCAGTCATCTCGTGTACTTACTAGACGACATCTTACTCTTACTGTTATCAAATATATTTTCAAAGCTAA CAGTATACATTCCACCAAAAAACTCGGCAAAATGTTATTTTTCGTTATATTTTCCATCACGATTGCTGTTGTGGCAGGTT TTGAATGTCCAGGAGGTCGACTAACACCACAGCAACGTAAAGATATCGTTCGTCAGAACAATAAATTTCGTTCATTACTA ATTCATGGAAAACTTAAAAATAGGAATGGTACATATATGCCACGCGGCAAGAATATGTTGCTACTGAAGTGGAGTTGTCA GTTAGAAAATTCTGCGCAAAGATGGGCAAATCAATGCGTCTTTGGGCACTCTCCGAGAAATCAAAGACAAGGAATCGGTG AAAATGTCTATGCCTACTGGTCATCAGAAAGCGTCGAAAAGCTTAGAAATACCGCTGGTACGGAAGCCGGCAAAAGTTGG TGGTCAGAACTTCCGAAACTGTACAAACAGAATCCTTCGAACAATCTGACTGATGATGTTGCCAGACAAGGTGTTTTACA TTTCACACAGATGGCCTGGGGTAAAACGCATAAAATTGGTTGTGGTATAGCAACAAACTGCGATGGTGGTCGCACACTCA TAGCTATTTGCCATTATTCACCCGCTGGAAATATGCTAAAAGAACTGATATATGAGCTTGGCGAACCATGCAAAACGGAT AGCGATTGTAACACAAAGAAATGTGCCAAAAAATCTGGATTGTGTAGAAAATGAAAGAGAGTTTAAAGTTTCACTTTTTG CACTCTTAATTTTGGTTTTATATTATAAAACTGAGAATTATTACAAACATATTTATTGGCTATTATAAGATAAAAAAGTT CCTTGAAATNCTTCTCAAATAAAATTTCTCTCTGATAAAAGCATGAAACCAAATGTTTTTTTCAACATCAAATAATTGAC CTAATCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CBrugiaQ_2426: (47 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
217603808425R47538SW3ICA101SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
217615808437R47550SW3ICA095SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
217730808552R47665SW3ICA092SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
217731808553R47666SW3ICA093SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
291577902109H30953SW3ICA175SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
291627902159H31003SW3ICA270SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
291631902163H31007SW3ICA274SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
291642902174H31018SW3ICA252SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
343524973928R95198SW3ICA365SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
343529973933R95203SW3ICA382SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
354132992902H52902SW3ICA454SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
3939221081911H91481SWMFCA064SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
3951091088246H92668SW3ICA528SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
3951121088249H92671SW3ICA531SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4123831122563H98341SW3ICA567SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4445681167369N43067SW3ICA1114SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4445961167397N43092SW3ICA1101SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4447221167619N43237SW3ICA605SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4447521167649N43267SW3ICA703SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4447621167659N43277SW3ICA714SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4450541182081N43616SW3ICA770SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4459141182931N44412SW3ICA1282SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4459371182954N44435SW3ICA1292SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4459431182960N44441SW3ICA1300SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
7061651592583AA072510SW3ICA1516SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
7061741592592AA072519SW3ICA1525SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
7061861592604AA072478SW3ICA1621SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
7061971592615AA072490SW3ICA1636SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
7062061592624AA072499SW3ICA1649SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
7155571619228AA080319SW3ICA1567SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
7155681619239AA080330SW3ICA1695SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
7496551663659AA111769SW3ICA1749SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
7621061681974AA123679SW3ICA1908SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
7641221685438AA125660SW3ICA1930SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
8249161769745AA185857SW3ICA1960SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
8679881850753AA228647SW3ICA2054SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
8962891889969AA255366SW3ICA2400SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
8963101889990AA255387SW3ICA2427SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
8963371890017AA255414SW3ICA2454SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
9139661911890AA272963SW3ICA2458SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
9139701911894AA272967SW3ICA2462SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
9141021912472AA273098SWMFCA1917SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
9141341912504AA273130SW3ICA2108SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
9141561912526AA273152SW3ICA2577SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
9245651926167AA283473SW3ICA2024SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
10751832113660AA430864RRAMCA363SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
10777462130929AA433452SW3ICA2340SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 11:52:22 on Thu 23 Nov 117.