CBrugiaQ_2439


Sequence

>CBrugiaQ_2439 (2 EST) Length=371 GTCCAATTGGTCCAGCCGGAAATGCTGGTGCGCCTGGTGAAAGTGCTGGACTGGTCCAGTAGGTCCACCAGGACCTCCGG GACACATGGACAACCAGGTATTGCTGGAACACCTGGACAACCCGGAGAGCCTGGAGCACCTGGTGGACAAGGACAGTAAT GCAGCATCACTGTCCTGGTACACCACGTTCCGCTAAAACCGCAGCTATTCATGAAATGGAACCATCCTATCGAAATTATA ATGAAGAGGGTGCTACTTATATTCGACGACATCATCGAACTCGAAAATCCAGAAAAATGCTCAAACAAGTTCAATGAATA ATATGTTCAGGTGGGAGAAAGGAAAGAAAAGGAATGTTTATTAAAATGAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CBrugiaQ_2439: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4445381167339N43037SW3ICA1033SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
7484561662327AA110580SW3ICA1802SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 6:26:53 on Thu 23 Nov 117.