CBrugiaQ_2443


Sequence

>CBrugiaQ_2443 (9 EST) Length=465 TTGTGGTAATATAAAAAATTTATTGTTACTTATTCTCAATAACAAAAAACGCGAACAAAAATTTCATTCCGTTTCCTCAT TCCTTAGCTTCTCGCAAACGCCTGATGGTACTGCGCACAGTGGCTGCTGCGGTTGTGCTGTATACATATGCACCACCAGC AACTATTTTATTGCATTTCGAACATTTCCAAATGCCAACACATTTTCGCTTCATCGACTCCTTTCCACAGAAAGCACATG TGTACTTAGAATGCTGTGTTACCTCCATCTTTTTAACAGTTTTTCTCAGTGAAGCACCATAACGAGTTCCATACTTCCCT ACTATGCCAACCTTCTTCGTCCGTTTAGCCATTTCGATAAGCTCAAACTTGGGTACAATCACAAACACGAAAAGCCATCT CATCCACCTCAACCCTGACACCAAACTTAATTTATTAGATGCAATGTCTTGGCTAAAAATAATAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CBrugiaQ_2443: (9 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
1435285
354097992871H52875SW3ICA417SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4449031172285N43402AS4SLC500T3Brugia malayi L4 JHU93SL-BmL4
7271871634832AA089353SWAFCA51SKBrugia malayi adult female cDNA (SAW96MLW-BmAF)
7620001681868AA123557MBAFCE7G10T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8558181817221AA216505MB2SLJ1E05T3Brugia malayi second stage larvae JHU96SL-BmL2
8808671870851AA241463MBL2SJ0E11T3Brugia malayi second stage larvae JHU96SL-BmL2
8986641893269AA257779MBL2SJ3B2T3Brugia malayi second stage larvae JHU96SL-BmL2
10988682168038AA454369MBAFCX0G04T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 6:15:8 on Wed 22 Nov 117.