CBrugiaQ_245


Sequence

>CBrugiaQ_245 (4 EST) Length=663 CCAAAAAATGGTTTTATTAGAAGAACCACAGATTAATGTACAGATACGCTGAACAGACATGGAATTTCATAACTAAATAT TAGCTGAAAAGGAAAAATCGAAATGTTGCGGAGTTACTGACTTAGCAATTTGCGTAAAATAGATCGCACAGGGATATCAA AAAGACTTCTTAATAAAACACTGTTAAAAAAGGAAATCAATAAACTCATCAATTTTCCACCGAACTTATATTTTCATTCT TTATCACCAGCAATCTTCTTTGGCAGCAGAACAGCATGAATATTCGGCAGCACACCACCTTGAGCGATAGTGACTCCAGA AAGAAGTTTGTTTAGTTCTTCGTCATTACGTACGGCTAACTGTAGATGACGAGGATTGATGCGGCTCTTTTTATTATCAC GAGCAGCATTACCCGCTAATTCGAGCACTTCTGCGGCAAGATACTCCAATACCGCTGCTAGATACACTGGAGCACCAGCG CCAACACGTTCAGCATAGTTTCCCTTGCGAAGAAGCCGATGTATTCGACCAACGGGAAATTGTAGACCAGCCCTGCTAGA GCGTGTCTTAGCTTTGGCTGATGATTTAGCTTTACCTCCTTTGCCTCGACCCGACATTTGGACTACTTTAAAGCGCACTT AAAATTTAATGACCTCAAACTTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CBrugiaQ_245: (4 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
1435248
6001311420969W91872RRAMCA217SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
6825871549415AA056785SWAMCA1518SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
8197261763907AA180689MBAFCG3C07T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 2:32:36 on Sat 25 Nov 117.