CBrugiaQ_2460


Sequence

>CBrugiaQ_2460 (4 EST) Length=854 AGCAGGAGACATCGTAGTAAGCTTTTCAGAAGTACGAATAGAACCGAAGCTGGGTGTTTTCGCGTGATGTTTTTCCACTT GTCGTATAGCAATTTTCCGTTTGTCATGGTAACGTTTCGCAATTGTTTCAGCTATACTTTGAGCTATTTTTTCCCTAACA GGTACTTCGGGAATCTTAAAAGCGGGGGCTGAAGTTGGAGTAGCCATATCTGAAGCATCAAGTCGAAATGGTGTCCCTTC GATTTCACCCCATGTCATAAATGGTGATTCGTCGACACCTGGAGTTAGTAATGGGGTAGCAATTAGTTCCACTATACCCG TCTTAGAACCCGCTTCACGCCCTGTTATATCCACCTTCCCTGCATTCATTACCGTCAGTTGAAGCATTCCCTTAACTGCA GTGACCTGTAAAATATCATTGTTGACTTCTTCTGAAAAACGAGTAGCGATTTTGTTTACGATTCTTTGATTTGCTTTCTG TCTTTGAAGATGTTCCTCCAGTGTTAACGGTGCATCTTCAGGGTGGAAATGCACAATATATCGCGCCTTATAAGACCAGT TATCAAGTTCTTTAGGCTTTGCCTCGAGCCGAACTCGGCACGCAGCCAAAGAGATCATGATTTGTTCATCAGCAGCCTTC ATTAATTCATTTCCTCGGGTAATCAATTCTTGGTTATGCTTCTTTTCTGCTTCATACATCCACGCGTTACGGATCTGTTC TTTTTTTTTATGTAACAGTGCAAGCTCTTCGAATGATGCATTATCCTCAGAGGTGAACTTATTTAAATAAGTATCAACCG TAAGATTTTCATCTTTCTTTTTCTTCTTTGCGGGGCTTCCTTTTTCACTTTTCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CBrugiaQ_2460: (4 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7566471673272AA118223MBAFCE6F09T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
10988312168001AA454332MBAFCX0C12T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11162222199363AA471599MBAFCX4D02T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11163052199446AA471682MBAFCX5D04T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 1:36:12 on Sat 18 Nov 117.