CBrugiaQ_2462


Sequence

>CBrugiaQ_2462 (2 EST) Length=391 GACTGTCGTATGTTTTAAGGTCACCAAAAATAATTTGTTCAAGCAGATAGTTCAAAACAAATAATTAGTGTTTTTGCTGA AATCAGTTTCTTACGGCAGATATAAATAATTTATCCCTTCTCCGCTGTAGTATGTACTAGATGTATTGTTCGTATATGCT TTCCATTTGCCATAACAAGGCCAACCATTCGAGAAGCCACATGATCATCATCTTCCATTGTTCCTTACAACCACTAAGAA TTATATTGGGTGTCGTTATCAGTGCACACAAATTTCCCTTCAATTATACGTCCATCCGTTAATTCGAGTCGTAAAATCTT CCCAAGCCATCGACGATATCCCTAAATCTTCTTGATCCGGCATAATAATTTCTCCTCAAACTTGGGTAATT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CBrugiaQ_2462: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4958771442868N89538KJ4SLB230T3JHU93SL-BmL4 (JHU)
10797572140377AA435463SWAMCA1596SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 6:44:7 on Tue 21 Nov 117.