CBrugiaQ_2466


Sequence

>CBrugiaQ_2466 (2 EST) Length=367 GGAAGGATTGCATCAGGGTTGGCTTCGTATGCTAACTGGTCTTTTTTCTANTGCTCTTTTTTTCTGAGATGATAGTCGCG ATGATTCTTGCACACTTCTCCTTAGTTTGTTTTTTTGCACTTTGTTCCTTTCCTTCACAGACTTGTTTGAGGATGCGGAA CTTTGTGTCACTTTTGAAATGGTATTTGACAAATTCATCTTTTTTGTCCGTCTCCCACTCGCACACTGCACGAGAACGAT GATCGCCAGTGGTACCACTCCAACCATCAACAAAACGACATCCTTTGGCTGCGCGTACATTTCACTACTGTACGGAACAA ACGGTTCTAATTGCCACAGTCGTATTTCTCTCGACAGCCGCAATAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CBrugiaQ_2466: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5304821300232W23378SWAMCA703SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
5305041300254W23413RRAMCA1268SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 19:30:36 on Sun 19 Nov 117.