CBrugiaQ_247


Sequence

>CBrugiaQ_247 (7 EST) Length=1014 TAACAAAAATAATAACTCACAGCTCTAACAATCATCGTAAGAGATGGTAAAAAGAGGGAATAGTAATTCACTATTTCACA ATTAACAACCNTCTTCTTGACTCTTTCGAACGCAGGCTGCTACACGTTTCTTGAATTCAGCAAAATTCTCGCGTTGCATC TTCGCGGCATCAACATTTGCAGGTGAATCGTGATTTGGATCTGCAAGCATCGATATAACAGAAAGAAGAATTGTTTCTAC GGTATGCACAGGTAACCACCTTTCTTCTGGCTTCTCGTAACCCCATCGATCATCTCCTGGTTCGTGCAATATCGATATGC AAACATTGCCTTCCTTGTCAATGTTCGGATGCCAAATTTCAGAAATGAACTTCATCTTTGGCGGCAACAATGGGTATTCC TTGGGAAATTCCAGAAGCGCTTTAAAGAATCCTCCTTCGTAAAGCGTGTCAGGCGGCCCAATAACAAGCACTTCCCATTT GTAGATGTCATCACCTTGAAGACCTGCTGAAAATCCATCAACAGGAACTCGTTTTAATTCTGCAAGTTGTTTTCTGAGAA GAAGCGCTGACTGCAATTCACCCATACTCCTCCACTAAAATAAGCCCACTACACCGCCAAAATAATAACAACCCTTTCTT TGTTCACCTCAAATGCAAACAACTAATTCTAGTTATTACAAAATTAACGAAAACAAAAAAATCGATAGCTATATTGAACA AAGACGAAGTACCATATGTAAAAAATGATACAACATCGCGTAATTAATAATTAAATATTCACTAAATGATATGCTTTGAT GAACTTATTTGCTTTGATGAACTTTTTGCGGTATGATCGTGCATATTACATAGATCATCAGCTCATTATCAAATAAATAA CCTATGGAATTTGACATATTTGAAATAAAACTTTACAGTACTCATTATTCACGGTAACATTTAAAATTTCTATGTTAAGT CAAAGATCAGCTCAATAAACCTAACAATATTTTACCCTATTACTGTCATTTCCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CBrugiaQ_247: (7 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
6826001549428AA056768SWAMCA1533SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
7271921634837AA089358SWAFCA58SKBrugia malayi adult female cDNA (SAW96MLW-BmAF)
11163412199482AA471718MBAFCX5G07T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11538452247059AA509182MBAFCX8C03T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11919342307176AA545885SWMFCA2435SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
12618112393007AA585595SW3D9CA276SKBrugia malayi L3 molting-day 9 larva cDNA (SAW97MLW-BmL3d9)
13813172655437AA675731MBAFCW4B04T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 16:32:39 on Sat 18 Nov 117.