CBrugiaQ_2498


Sequence

>CBrugiaQ_2498 (5 EST) Length=377 CAAGTTTGAGTGCTACAAACTACTGACGATGAATCTGACAGTACTCAGTATTCTACTTATTACGCTGTTCCACCAACAAT ATTTCACCCAAGCAGCACCTCCTCCTTTCGTTGGATCCATGAATCCGTATATGAATGTATTGGGATCAGATGCCGACGGT TCATTGCCAAATGGAGATAAAAAATTATGGAAGCGAAAAGTAGAGGAGCCATTTCATTTGGCTCATTTAAGATTTGGATG AAAACAATTAACCTGTCATTCTGTTTTTATCAAAACATATTTTTGATTACTTTTTTTGACTATTTGATAAGATCCTATAA ATGCTTAACGGTTTGTAAACATAACATTTGTAATTACTTCAATGAACAGCTTGCANC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST, Processing,


Cluster Information for CBrugiaQ_2498: (5 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
217736808558R47671SWAMCA117SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
5072401271724W00310RRAMCA1121SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
6722041537151AA051986SWAMCA1466SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
10750732113550AA430793RRAMCA1458SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
10987322167902AA454233RRAMCA136SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 11:54:22 on Fri 24 Nov 117.