CBrugiaQ_250


Sequence

>CBrugiaQ_250 (3 EST) Length=666 GAGTGTTCCAACCAGCCATTCGATATATTTAGCTGGTGATCAAATAGAGAGTGATGTCGGATGAGGAAATGGAACAAACT ACCCATACCCAATCGTCTCCGCATGAAGAAGCGATGGAAGAAGATTCGGTTCAAAGTAATGAAGGTGATGCTGCGGAAGA AGATCACGACGATGAAGACATTGCTGAAGAAACAAATGCATTAGAGCATTCTCGTTCTACCAAACGTAAAAAAGGTTCAA AGAAAGGACGATTAAAAAAAAGAAGGGAAAGTGCCATTGAACAAAATGCTAGTTCGGCAGAGATTTGCACAATGCTTGGT CTGAATGATGTACCAAATAATTTCACAGAGGAAGATATCAACTCAATTAGTTCTGCAAAGGCATTTGCATTGCGAGTAAA GCCACAACTGCAAGCTGCGAATCCAAAGGCGCTTTTTACAAAGCTGCAGCAGCTGATCCAGGCAAAATATCGGGAATTCC AGGAAGANATGGCAGCCCAGGGACGACCGATTGGTTCCAGTTGAAAAAGTCACGTTCATCCAGCATCTGGGTTGATAAAG TTGTTTGCACCGATCAAAATTCCAATAAGTGCTAGAAAGAAACGGCGTTATGACAATGATGATGATGACCCTAATCCAGA TAGTGACCAAGAATTTGAGCATTTAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CBrugiaQ_250: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
281246890003H21308AS3ISB212SLBrugia malayi infective L3 JHU93SL-BmL3
6826911549519AA056880SWMFCA991SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
11253172209385AA480687SWMFCA2033SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 4:41:38 on Wed 22 Nov 117.