CBrugiaQ_2501


Sequence

>CBrugiaQ_2501 (16 EST) Length=427 TCTNCCCTTTTTTTTNCCCCGGAATTAACGAATGCATTTATCTGATGGCACGAGTGAGGACAAAAATTATTTCGACGACC GAAGGAAAAGATGGCGGAAGCAGAATGATTATCACAGGTTCTTCAGTCCTTTTATGCAATCTGCAGGCAATTTCTGGCAT CTTTGTTTGTCGCTTTTCACGTTTTTCATACAGATGTCAACATGTATATCGCATTTGGTTGTACATAGTCGATGTGCCGG TATCCATTCTTTGTCATTTTCAAAAGGATCACCACATTCTTTGGGGTGCGTGAATATATATTTGAAGATTTTCTTCAACT CGGATTTTTCCTCTGCTTTCATAAGCAAAACAACACATATGCTGAGAAAATACAAATATCGGAAACACATTCCTGCTGCT CAAACTTGGGTAATATATAAACAGCTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CBrugiaQ_2501: (16 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
1435284
325132951342R88406TNPIBM4003Brugia malayi infective L4 JHU93SL-BmL4
4061611115066H97294KJ4SLB020T3JHU93SL-BmL4 (JHU)
4157141122657H98436KJ4SLB131T3JHU93SL-BmL4 (JHU)
4157311122674H98453KJ4SLB154T3JHU93SL-BmL4 (JHU)
4449011172283N43400AS4SLC507T3Brugia malayi L4 JHU93SL-BmL4
4449121172294N43411AS4SLC531T3Brugia malayi L4 JHU93SL-BmL4
4449271172309N43426AS4SLC552T3Brugia malayi L4 JHU93SL-BmL4
7062201592638AA072537MB4SLD057T3Brugia malayi L4 JHU93SL-BmL4
7062401592658AA072557MB4SLD030T3Brugia malayi L4 JHU93SL-BmL4
8678781850643AA228537KJ4SLB311T3JHU93SL-BmL4 (JHU)
8982051892810AA257308MB4SLM1E1T3Brugia malayi L4 JHU93SL-BmL4
8982251892830AA257354MB4SLM1G9T3Brugia malayi L4 JHU93SL-BmL4
8982951892900AA257333MB4SLM2G5T3Brugia malayi L4 JHU93SL-BmL4
11887512289615AA542703MB4SLY2C08T3Brugia malayi L4 JHU93SL-BmL4
11887892289653AA542741MB4SLY2G07T3Brugia malayi L4 JHU93SL-BmL4


Date: 0:38:15 on Thu 23 Nov 117.