CBrugiaQ_2507


Sequence

>CBrugiaQ_2507 (2 EST) Length=375 AATTGTTTTCAATTTTTTCATATGGCCCCAATTGCAGTAAGCTTGCGTTGTAAGATGCCGTCCCTTTTTGCTGCACAAAT TTCAGCGCAACCTCCAAAAAATTCACCGCCGATGAAAATTCCGCGGCACTCTTCTTGATCCAGTTATCTGTTCCATATAA TCCAAAATTTCTTTTCCATCAGACCTTTTGTTGATGTCGATCCATTCCATTGCGATCTCCTTCGAGAGGATACGAGGCAA GCGCTTTACGTGTTCGTTTACAATATATGCACCAACTCTTTGATATTACTACTATCTGCGGAACATGTTTGGAAACCAAG AAGCCCATTTTTCATATATAATCCAGTAGTCGAAATTAGTGATACACTCAAACTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CBrugiaQ_2507: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8679491850714AA228621RRAMCA332SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
8712931854365AA231951AS3ISB008T3Brugia malayi infective L3 JHU93SL-BmL3


Date: 14:0:58 on Mon 20 Nov 117.