CBrugiaQ_2516


Sequence

>CBrugiaQ_2516 (2 EST) Length=373 AGTATCATTCGCTGTTTCGTATTCACATCGGAATCCTTCGGGACAAGTAATTAAACACGTATGAATTCCAATATCTGCGG CTAGTAGAGGTTCTCCACCGTCGCGACAGTTCGGAATTTCCCCACCATAATCCAGTTCTTCGGGTAGTGGTATTGCACTA ATGGACAGCACAAATAACAATCCTAAACAATGATAAAACATTGGGGTAATTGTAGAGCACGATGCTGCACTGGTGGATGG ATACTACTCGTTGAAGAATCAACTCCGCAAACTAACAATTTTTTACCATTAAATAGTTGTTCCTGACGAATACAGATGGA AAGTGGTACCACATTGATGAGGATAAGTAGAGAGCTCATCTTTCTTCTTCTTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CBrugiaQ_2516: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9165171917137AA275489MBL2SK1C11T3Brugia malayi second stage larvae JHU96SL-BmL2
11162022199343AA471579MBAFCX4B02T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 16:39:4 on Sat 18 Nov 117.