CBrugiaQ_2517


Sequence

>CBrugiaQ_2517 (27 EST) Length=1193 AAACCTAATAAATAACCTAAAGATCAACCTTTTCAACACTCTAAAGAAGTTAACTCTAAAGCAATAGGTATAAAACTATG ATTAGCACCACAGATTTCTGAACACTGACCATAAAACAATCCACAACAAGAAAAATTAAAAGTAACCTTAGTTAACAAAC CATTCAAAGCATCCATTTTAATAAAACACTTAGGTACAGCAAAAGAATGAATAACATCATTAGAAGTGCAATAAAAACCA ACATTTACACCGACAGGTAAAACACAACGGTTATCAACATCAAATAAACGAAAATCACCAATATCCAAATCATCTACTGG CTTCATGAACGAATCAAAATTCAACCTACCATTATCCCCATATTCATAACTTCAATATCATTGGTGACCAATAACCTTTA AAGTTAATTCAGACTGCCGAAACATACGACCTTGATACTGAATTAACCAAAAACCTGGACCAGCCATAACTACTAAAAAA TTAACAACTAAAACTTGCAAAACCAACTCGATCATACGACTATCTNTACGTTTTAAATTAAATTTAAAAGAATTACCAAA AAAATATAAAACTAACCTAACAATAAATCGATAAGTAATAAAAAGCACTGAAAATAATAGAATGAAATAGGACTGATAAT CACAGAGACAATCATACTGACGAGAGTACCTTTGTCTCCAAAATATTCACCTGCAAAAAATCTTCCCATGGTTTCTCCCA TACCTCCAATGTCATCACCTGATCCGGGTGTCCTTCCAATTTTTTACATGTTTTCAAGTTAAATTGCTCAACTTGCAATT TTTTTGCATTCTGATCGAGCAACCTGTACTTCCATCTTATATTTCACACCGGCGACAACTTGAGATGAAACGTTTAGCAA TTTGATTGGCATCAAATGGTACTCATCGTTTGATTGTTGATTTACTTTAGTTAAAACACTTGGCAATAGCTCCAGTATTT CGTTATCTTCTGGACTACGTTCTTGCCATCCTCCCAATAAAACTTGGCCACGCTGCATTTGTCCTTTTGATTCCATATGA GGAATTTCTCGTCGATGAATCAATGCTGTCGTATCAAATAAAAATAATGATAATAATATCACCAACAATCCTTCTTTTAT TGACATCGTTGACATCATCAAATCGTTGCTTATTTTGTTTACACAGTTGGTCTCAGAACTCNTGGCCGAATTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CBrugiaQ_2517: (27 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
217600808422R47535SW3ICA038SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
291648902180H31024SW3ICA259SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
343569973973R95243SW3ICA407SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
344490975355R95294SW3ICA410SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4427311164879N41281SW3ICA1011SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4452181182245N43717SW3ICA798SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4459421182959N44440SW3ICA1299SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4706461215777N64895SW3ICA1360SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
7472211660831AA109361MBAFCE1A08T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
7484501662321AA110574SW3ICA1729SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
7496601663664AA111774SW3ICA1860SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
8390231795688AA199945SW3ICA1975SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
8640341845482AA224698SW3ICA2028SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
9139571911881AA272954SW3ICA2391SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
9141331912503AA273129SW3ICA2107SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
9214541923305AA280444SW3ICA2604SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
11162092199350AA471586MBAFCX4B10T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11939242315076AA547875MB3D6V2B10T3Brugia malayi day 6 post-infection third stage larvae SAW96MLW-BmL3d6
11939342315086AA547885MB3D6V2C11T3Brugia malayi day 6 post-infection third stage larvae SAW96MLW-BmL3d6
13666432605181AA661137MB3D6V3B07T3Brugia malayi day 6 post-infection third stage larvae SAW96MLW-BmL3d6
13666452605183AA661139MB3D6V3C01T3Brugia malayi day 6 post-infection third stage larvae SAW96MLW-BmL3d6
13666792605217AA661173MB3D6V3F10T3Brugia malayi day 6 post-infection third stage larvae SAW96MLW-BmL3d6
13666872605225AA661181MB3D6V3G09T3Brugia malayi day 6 post-infection third stage larvae SAW96MLW-BmL3d6
13667302605268AA661224MB3D6V4D01T3Brugia malayi day 6 post-infection third stage larvae SAW96MLW-BmL3d6
13668122605350AA661306MB3D6V5D04T3Brugia malayi day 6 post-infection third stage larvae SAW96MLW-BmL3d6
13668182605356AA661312MB3D6V5D12T3Brugia malayi day 6 post-infection third stage larvae SAW96MLW-BmL3d6
13668422605380AA661336MB3D6V5G09T3Brugia malayi day 6 post-infection third stage larvae SAW96MLW-BmL3d6


Date: 23:21:4 on Sun 19 Nov 117.